KIAA0832

Product ID	ORK00649
Accession No	AB020639
Description	estrogen-related receptor gamma, transcript variant 1
Clone name	hj04617
Vector information	The cDNA fragment was inserted at the SalI-NotI site of the ... The cDNA fragment was inserted at the SalI-NotI site of the pBluescript II SK(+) vector (GenBank Accession No. X52328, AmpR). The 5' end of the cDNA was repaired and ligated with the SalI adapter (5'TCGACCCACG CGTCCG3') and inserted at the SalI site of the vector. The 3'end of the cDNA was inserted at the NotI site of the vector.
cDNA sequence	DNA sequence (5216 bp) Predicted protein sequence (469 aa)
HaloTag ORF Clone	FHC00649
Flexi ORF Clone	FXC00649
Source	Human adult brain
Rouge ID	mKIAA0832 by Kazusa Mouse cDNA Project

Length: 5216 bp

Physical map

Restriction map

Prediction of protein coding region (GeneMark analysis).

	N-terminal truncation	Coding interruption
cloned DNA seq	No warning	No warning

Integrity of 3' end

Length of 3'UTR	3685 bp
Genome contig ID	gi89161185r_214643219
PolyA signal sequence (ATTAAA,-20)	+--------+--------+----*----+---- TGATGGTAGAGCAATATTAAACAAGCTTCCACTTT
Flanking genome sequence (100000 - 99951)	----+--------+--------+--------+--------+----* TGACTGCTCTTTTGTATTGTGTTTCTTTTTTTCCCCCCGCTAAAGAACCA

Ensembl ContigView (Add our DAS server as a DAS source)

	Chr	f/r	start	end	exon	identity	class
Ensembl gnome browser	1	r	214743219	214963418	7	100.0	Perfect prediction

Length: 469 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	Exp	ID%	Protein	Source
P62510	5e-183	100.0	Estrogen-relate...	Rattus norvegicus
AAQ93376	1e-182	99.8	estrogen-relate...	Homo sapiens
XP_001105251	1.2e-182	99.8	similar to Estr...	Macaca mulatta
AAQ90023	1.4e-182	99.8	estrogen recept...	Rattus norvegicus
XP_858518	5.9e-181	98.3	similar to Estr...	Canis lupus fam...

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against HUGE database (FASTA output, Multiple alignment)

No significant homologues

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method	interpro_ID	From	To	Entry	Definition
BlastProDom	IPR001628	138	204	PD000035	Zinc finger
FPrintScan	IPR001628	139	155	PR00047	Zinc finger
	IPR001628	155	170	PR00047	Zinc finger
	IPR001628	188	196	PR00047	Zinc finger
	IPR001628	196	204	PR00047	Zinc finger
	IPR001723	200	210	PR00398	Steroid hormone receptor
	IPR000003	210	224	PR00545	Retinoid X receptor
	IPR000003	273	293	PR00545	Retinoid X receptor
	IPR001723	282	303	PR00398	Steroid hormone receptor
	IPR001723	303	319	PR00398	Steroid hormone receptor
	IPR000003	317	334	PR00545	Retinoid X receptor
	IPR000003	356	376	PR00545	Retinoid X receptor
	IPR001723	370	385	PR00398	Steroid hormone receptor
	IPR000003	396	413	PR00545	Retinoid X receptor
	IPR000003	417	436	PR00545	Retinoid X receptor
	IPR001723	427	444	PR00398	Steroid hormone receptor
	IPR000003	444	463	PR00545	Retinoid X receptor
HMMPfam	IPR001628	137	212	PF00105	Zinc finger
HMMPfam	IPR000536	284	464	PF00104	Nuclear hormone receptor
HMMSmart	IPR001628	136	207	SM00399	Zinc finger
HMMSmart	IPR000536	281	439	SM00430	Nuclear hormone receptor
ProfileScan	IPR001628	136	211	PS51030	Zinc finger
ScanRegExp	IPR001628	139	165	PS00031	Zinc finger

Primer_f	AAGAGAAAATGGGTGTTGGTG
Primer_r	CTACTGGCTATAATGCAACTC
PCR conditions	95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

Panel name	UniGene
Primer_f	-
Primer_r	-
PCR product length	-
PCR conditions	-