KIAA0838

Product ID	ORK01998
Accession No	AB020645
Description	glutaminase, transcript variant 1
Clone name	hk03864
Vector information	The cDNA fragment was inserted at the SalI-NotI site of the ... The cDNA fragment was inserted at the SalI-NotI site of the pBluescript II SK(+) vector (GenBank Accession No. X52328, AmpR). The 5' end of the cDNA was repaired and ligated with the SalI adapter (5'TCGACCCACG CGTCCG3') and inserted at the SalI site of the vector. The 3'end of the cDNA was inserted at the NotI site of the vector.
cDNA sequence	DNA sequence (4198 bp) Predicted protein sequence (677 aa)
HaloTag ORF Clone	FHC01998
Flexi ORF Clone	FXC01998
Source	Human adult brain
Rouge ID	mKIAA0838 by Kazusa Mouse cDNA Project

Length: 4198 bp

Physical map

Restriction map

Prediction of protein coding region (GeneMark analysis).

	N-terminal truncation	Coding interruption
cloned DNA seq	No warning	No warning

Integrity of 3' end

Length of 3'UTR	1938 bp
Genome contig ID	gi89161199f_191353892
PolyA signal sequence (AATAAA,-23)	+--------+--------+----*----+---- AGGCTTTTCTATAATAAAAAGAGGTTCTAACCATT
Flanking genome sequence (184005 - 184054)	----+--------+--------+--------+--------+----* ATTTGGGAACAAAGAGAGTTTTCATCTTTTTTCAGATCAAAACCATTCTG

Ensembl ContigView (Add our DAS server as a DAS source)

	Chr	f/r	start	end	exon	identity	class
Ensembl gnome browser	2	f	191453806	191537895	18	99.5	Perfect prediction

Length: 677 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	ID%	Protein	Source
O94925	100.0	Glutaminase kid...	Homo sapiens
BAF82436	99.9	unnamed protein...	Homo sapiens
AAX29892	100.0	glutaminase [sy...	synthetic construct
AAG47842	99.9	glutaminase [Ho...	Homo sapiens
NP_036701	94.2	glutaminase iso...	Rattus norvegicus

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against HUGE database (FASTA output, Multiple alignment)

No significant homologues

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method	interpro_ID	From	To	Entry	Definition
FPrintScan	IPR002110	594	606	PR01415	Ankyrin
FPrintScan	IPR002110	606	618	PR01415	Ankyrin
HMMPfam	IPR015868	252	538	PF04960	Glutaminase
	IPR002110	593	626	PF00023	Ankyrin
	IPR002110	627	659	PF00023	Ankyrin
HMMSmart	IPR002110	593	623	SM00248	Ankyrin
HMMSmart	IPR002110	627	656	SM00248	Ankyrin
ProfileScan	IPR002110	560	659	PS50297	Ankyrin
ProfileScan	IPR002110	593	615	PS50088	Ankyrin

Primer_f	CAAGCCATGGAGACAGGTAGC
Primer_r	TAGTCACACAAAGCGGGCTGC
PCR conditions	95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

Panel name	GeneBridge 4
Primer_f	CAAGCCATGGAGACAGGTAGC
Primer_r	TAGTCACACAAAGCGGGCTGC
PCR product length	139 bp
PCR conditions	95 °C15 sec66 °C60 sec30 cycles