Gene/Protein Characteristic Table for KIAA0857
Order Kazusa clone(s) from : Japan || Other countries
Product ID ORK00661
Accession No AB020664
Description RAB11 family interacting protein 5 (class I)
Clone name hk06227
Vector information
The cDNA fragment was inserted at the SalI-NotI site of the ...
cDNA sequence DNA sequence (4341 bp)
Predicted protein sequence (733 aa)
Flexi ORF Clone FXC00661
Source Human adult brain
Rouge ID mKIAA0857 by Kazusa Mouse cDNA Project
Features of the cloned cDNA sequence
Description

Length: 4341 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis).

N-terminal truncation Coding interruption
cloned DNA seq Warning No warning
Integrity of 3' end
Length of 3'UTR 2138 bp
Genome contig ID gi89161199r_73054019
PolyA signal sequence
(AATAAA,-21)
+----*----+----*----+----*----+----
AGCACTTTATGAAGAATAAAACATTCATGTACTGC
Flanking genome sequence
(100000 - 99951)
----+----*----+----*----+----*----+----*----+----*
AGGTGGCTCTGTTGTGTTCCTGTTTTGGAATGAACAGTTACAGGAGGCTG

Ensembl ContigView (Add our DAS server as a DAS source)


Chr f/r start end exon identity class
Ensembl gnome browser 2 r 73154019 73193654 5 99.3 Perfect prediction
Features of the protein sequence
Description

Length: 733 aa
Result of homology search against nr database (FASTA output, Multiple alignment)
Entry Exp ID% Protein Source
XP_001103469 0 97.7 similar to RAB1...
Macaca mulatta
Q9BXF6 0 100.0 Rab11 family-in...
Homo sapiens
AAH35013 0 99.5 RAB11 family in...
Homo sapiens
XP_616110 1.4e-211 90.2 similar to RAB1...
Bos taurus
XP_001917193 2.2e-205 88.8 RAB11 family in...
Equus caballus
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
Result of homology search against HUGE database (FASTA output, Multiple alignment)
Entry Exp ID% HUGE_ID
AB023158 1.8e-13 30.9 KIAA0941
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
Result of motif / domain search (InterProScan and SOSUI)

Result of InterProScan

Search method interpro_ID From To Entry Definition
HMMPfam IPR000008 101 165 PF00168 C2 calcium-dependent membrane targeting
HMMSmart IPR000008 100 223 SM00239 C2 calcium-dependent membrane targeting
ProfileScan IPR000008 97 208 PS50004 C2 calcium-dependent membrane targeting
ScanRegExp IPR001753 81 101 PS00166 Crotonase
Expression profile
Description

RT-PCR-ELISA
Experimental conditions
Primer_f TGAGGTGCTGAAGAAGGATAC
Primer_r AAAGCATGACTGAAACCCTGG
PCR conditions 95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

RH mapping information
Description

Chromosome No. 2
Experimental conditions
Panel name GeneBridge 4
Primer_f TCCTCTGGGCTTTATTCACTC
Primer_r GAAACATCAACAAGGACCCTG
PCR product length 122 bp
PCR conditions 95 °C15 sec62 °C60 sec30 cycles
Order Kazusa clone(s) from : Japan || Other countries
Back to the HUGE Protein Database homepage
Send a message to office AT kazusa.or.jp