Order Kazusa clone(s) from : ![]() |
Product ID | ORK00661 |
---|---|
Accession No | AB020664 |
Description | RAB11 family interacting protein 5 (class I) |
Clone name | hk06227 |
Vector information | |
cDNA sequence | DNA sequence (4341 bp) Predicted protein sequence (733 aa) |
HaloTag ORF Clone |
FHC00661
![]() |
Flexi ORF Clone | FXC00661 |
Source | Human adult brain |
Rouge ID |
mKIAA0857
by Kazusa Mouse cDNA Project
|
N-terminal truncation | Coding interruption | |
---|---|---|
cloned DNA seq | Warning | No warning |
Length of 3'UTR | 2138 bp |
---|---|
Genome contig ID | gi89161199r_73054019 |
PolyA signal sequence (AATAAA,-21) |
+----*----+----*----+----*----+---- |
Flanking genome sequence (100000 - 99951) |
----+----*----+----*----+----*----+----*----+----* |
Ensembl ContigView (Add our DAS server as a DAS source)
Chr | f/r | start | end | exon | identity | class | |
---|---|---|---|---|---|---|---|
| 2 | r | 73154019 | 73193654 | 5 | 99.3 | Perfect prediction |
![]() |
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
Search method | interpro_ID | From | To | Entry | Definition |
---|---|---|---|---|---|
HMMPfam | IPR000008 | 101 | 165 | PF00168 | C2 calcium-dependent membrane targeting |
HMMSmart | IPR000008 | 100 | 223 | SM00239 | C2 calcium-dependent membrane targeting |
ProfileScan | IPR000008 | 97 | 208 | PS50004 | C2 calcium-dependent membrane targeting |
ScanRegExp | IPR001753 | 81 | 101 | PS00166 | Crotonase |
![]() |
Primer_f | TGAGGTGCTGAAGAAGGATAC |
---|---|
Primer_r | AAAGCATGACTGAAACCCTGG |
PCR conditions | 95 °C![]() ![]() ![]() ![]() ![]() ![]() ![]() |
Panel name | GeneBridge 4 |
---|---|
Primer_f | TCCTCTGGGCTTTATTCACTC |
Primer_r | GAAACATCAACAAGGACCCTG |
PCR product length | 122 bp |
PCR conditions | 95 °C![]() ![]() ![]() ![]() |