KIAA0857

Product ID	ORK00661
Accession No	AB020664
Description	RAB11 family interacting protein 5 (class I)
Clone name	hk06227
Vector information	The cDNA fragment was inserted at the SalI-NotI site of the ... The cDNA fragment was inserted at the SalI-NotI site of the pBluescript II SK(+) vector (GenBank Accession No. X52328, AmpR). The 5' end of the cDNA was repaired and ligated with the SalI adapter (5'TCGACCCACG CGTCCG3') and inserted at the SalI site of the vector. The 3'end of the cDNA was inserted at the NotI site of the vector.
cDNA sequence	DNA sequence (4341 bp) Predicted protein sequence (733 aa)
HaloTag ORF Clone	FHC00661
Flexi ORF Clone	FXC00661
Source	Human adult brain
Rouge ID	mKIAA0857 by Kazusa Mouse cDNA Project

Length: 4341 bp

Physical map

Restriction map

Prediction of protein coding region (GeneMark analysis).

	N-terminal truncation	Coding interruption
cloned DNA seq	Warning	No warning

Integrity of 3' end

Length of 3'UTR	2138 bp
Genome contig ID	gi89161199r_73054019
PolyA signal sequence (AATAAA,-21)	+--------+--------+----*----+---- AGCACTTTATGAAGAATAAAACATTCATGTACTGC
Flanking genome sequence (100000 - 99951)	----+--------+--------+--------+--------+----* AGGTGGCTCTGTTGTGTTCCTGTTTTGGAATGAACAGTTACAGGAGGCTG

Ensembl ContigView (Add our DAS server as a DAS source)

	Chr	f/r	start	end	exon	identity	class
Ensembl gnome browser	2	r	73154019	73193654	5	99.3	Perfect prediction

Length: 733 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	Exp	ID%	Protein	Source
XP_001103469	0	97.7	similar to RAB1...	Macaca mulatta
Q9BXF6	0	100.0	Rab11 family-in...	Homo sapiens
AAH35013	0	99.5	RAB11 family in...	Homo sapiens
XP_616110	1.4e-211	90.2	similar to RAB1...	Bos taurus
XP_001917193	2.2e-205	88.8	RAB11 family in...	Equus caballus

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against HUGE database (FASTA output, Multiple alignment)

Entry	Exp	ID%	HUGE_ID
AB023158	1.8e-13	30.9	KIAA0941

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method	interpro_ID	From	To	Entry	Definition
HMMPfam	IPR000008	101	165	PF00168	C2 calcium-dependent membrane targeting
HMMSmart	IPR000008	100	223	SM00239	C2 calcium-dependent membrane targeting
ProfileScan	IPR000008	97	208	PS50004	C2 calcium-dependent membrane targeting
ScanRegExp	IPR001753	81	101	PS00166	Crotonase

Primer_f	TGAGGTGCTGAAGAAGGATAC
Primer_r	AAAGCATGACTGAAACCCTGG
PCR conditions	95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

Panel name	GeneBridge 4
Primer_f	TCCTCTGGGCTTTATTCACTC
Primer_r	GAAACATCAACAAGGACCCTG
PCR product length	122 bp
PCR conditions	95 °C15 sec62 °C60 sec30 cycles