KIAA0859

Product ID	ORK01611
Accession No	AB020666
Description	methyltransferase like 13, transcript variant 1
Clone name	hk06485s1
Vector information	The cDNA fragment was originally inserted at SalI-NotI site ... The cDNA fragment was originally inserted at SalI-NotI site of the pBluescript II SK(+) vector (GenBank Accession No. X52328) with the SalI adapter (5'TCGACCCACG CGTCCG3') and its XhoI-NotI DNA fragment was inserted at the XhoI-NotI site of the pYO326 vector (Amp-r). pYO326 shuttle vector was kindly provided by Y. Ohya (University of Tokyo).
cDNA sequence	DNA sequence (2404 bp) Predicted protein sequence (707 aa)
HaloTag ORF Clone	FHC01611
Flexi ORF Clone	FXC01611
Source	Human adult brain
Rouge ID	mKIAA0859 by Kazusa Mouse cDNA Project
Note	We replaced hk06485, former representative clones for KIAA0859 with hk06485s1. (2002/5/10)

Length: 2404 bp

Physical map

Restriction map

Prediction of protein coding region (GeneMark analysis).

	N-terminal truncation	Coding interruption
cloned DNA seq	No warning	No warning

Integrity of 3' end

Length of 3'UTR	202 bp
Genome contig ID	gi89161185f_169917629
PolyA signal sequence (None)	+--------+--------+----*----+---- AATAAAAATGTCCTTCCCATCTTGTCCTCTTCAGT
Flanking genome sequence (115094 - 115143)	----+--------+--------+--------+--------+----* ACCACTTGGGTTGGTTTGTCTTTGCTTCCTACACCACGTCCTTGAGTGGA

Ensembl ContigView (Add our DAS server as a DAS source)

	Chr	f/r	start	end	exon	identity	class
Ensembl gnome browser	1	f	170017629	170032721	8	100.0	Perfect prediction

Length: 707 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	ID%	Protein	Source
BAF84429	99.9	unnamed protein...	Homo sapiens
XP_001146517	99.6	CGI-01 protein ...	Pan troglodytes
BAG51342	99.6	unnamed protein...	Homo sapiens
BAG65285	100.0	unnamed protein...	Homo sapiens
XP_001146579	99.6	CGI-01 protein ...	Pan troglodytes

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against HUGE database (FASTA output, Multiple alignment)

No significant homologues

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method	interpro_ID	From	To	Entry	Definition
HMMPfam	IPR013216	61	166	PF08241	Methyltransferase type 11

Primer_f	GCCTAGACTGACCTTGGACTC
Primer_r	AGAGGACAAGATGGGAAGGAC
PCR conditions	95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

Panel name	UniGene
Primer_f	-
Primer_r	-
PCR product length	-
PCR conditions	-