Order Kazusa clone(s) from : ![]() |
Product ID | ORK00663 |
---|---|
Accession No | AB020667 |
Description | U-box domain containing 5, transcript variant 1 |
Clone name | hk06518 |
Vector information | |
cDNA sequence | DNA sequence (4313 bp) Predicted protein sequence (551 aa) |
Flexi ORF Clone | FXC00663 |
Source | Human adult brain |
Rouge ID |
mKIAA0860
by Kazusa Mouse cDNA Project
|
N-terminal truncation | Coding interruption | |
---|---|---|
cloned DNA seq | No warning | No warning |
Length of 3'UTR | 2533 bp |
---|---|
Genome contig ID | gi51511747r_2936220 |
PolyA signal sequence (AATAAA,-21) |
+----*----+----*----+----*----+---- |
Flanking genome sequence (252305 - 252256) |
----+----*----+----*----+----*----+----*----+----* |
Ensembl ContigView (Add our DAS server as a DAS source)
Chr | f/r | start | end | exon | identity | class | |
---|---|---|---|---|---|---|---|
| 20 | r | 3019818 | 3088524 | 9 | 98.6 | Terminal No-hit |
![]() |
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
![]() |
Primer_f | TTCCCTTCTAAGCACGTTTGG |
---|---|
Primer_r | GTATTGGGTGTGGACTAGAGC |
PCR conditions | 95 °C![]() ![]() ![]() ![]() ![]() ![]() ![]() |
Panel name | UniGene |
---|---|
Primer_f | - |
Primer_r | - |
PCR product length | - |
PCR conditions | - |