KIAA0868

Product ID	ORK04596
Accession No	AB020675
Description	contactin associated protein-like 2
Clone name	hk06919
Vector information	The cDNA fragment was inserted at the SalI-NotI site of the ... The cDNA fragment was inserted at the SalI-NotI site of the pBluescript II SK(+) vector (GenBank Accession No. X52328, AmpR). The 5' end of the cDNA was repaired and ligated with the SalI adapter (5'TCGACCCACG CGTCCG3') and inserted at the SalI site of the vector. The 3'end of the cDNA was inserted at the NotI site of the vector.
cDNA sequence	DNA sequence (4185 bp) Predicted protein sequence (1339 aa)
Source	Human adult brain
Rouge ID	mKIAA0868 by Kazusa Mouse cDNA Project

Length: 4185 bp

Physical map

Restriction map

Prediction of protein coding region (GeneMark analysis).

	N-terminal truncation	Coding interruption
cloned DNA seq	Warning	No warning

Integrity of 3' end

Length of 3'UTR	164 bp
Genome contig ID	gi89161213f_145344877
PolyA signal sequence (AATATA,-31)	+--------+--------+----*----+---- ATGGAATATAATGGAATATTCTTGAGACTGATCAC
Flanking genome sequence (2398930 - 2398979)	----+--------+--------+--------+--------+----* AAAAAAAAAAACCTTTTTAATATTTCTTTATAGCTGAGTTTTCCCTTCTG

Ensembl ContigView (Add our DAS server as a DAS source)

	Chr	f/r	start	end	exon	identity	class
Ensembl gnome browser	7	f	146167734	147743805	18	99.9	Both No-hit

Length: 1339 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	ID%	Protein	Source
Q9UHC6	100.0	Contactin-assoc...	Homo sapiens
BAG37571	99.9	unnamed protein...	Homo sapiens
XP_519462	99.5	cell recognitio...	Pan troglodytes
XP_001094652	98.6	cell recognitio...	Macaca mulatta
Q5RD64	98.5	Contactin-assoc...	Pongo abelii

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against HUGE database (FASTA output, Multiple alignment)

Entry	Exp	ID%	HUGE_ID
AB051550	0	48.4	KIAA1763
AB051501	0	48.3	KIAA1714
AB018286	2.3e-28	24.5	KIAA0743
AB011150	6.1e-26	23.8	KIAA0578
AB023138	3.1e-14	23.9	KIAA0921

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method	interpro_ID	From	To	Entry	Definition
HMMPfam	IPR000421	55	186	PF00754	Coagulation factor 5/8 type
	IPR012680	224	353	PF02210	Laminin G
	IPR012680	409	537	PF02210	Laminin G
	IPR006209	566	598	PF00008	EGF-like
	IPR012680	835	953	PF02210	Laminin G
	IPR012680	1063	1195	PF02210	Laminin G
HMMSmart	IPR000421	42	189	SM00231	Coagulation factor 5/8 type
	IPR001791	216	353	SM00282	Laminin G
	IPR001791	401	537	SM00282	Laminin G
	IPR006210	565	599	SM00181	EGF
	IPR001791	827	953	SM00282	Laminin G
	IPR006210	974	1010	SM00181	EGF
	IPR001791	1055	1195	SM00282	Laminin G
	IPR003585	1290	1308	SM00294	Neurexin/syndecan/glycophorin C
ProfileScan	IPR000421	43	189	PS50022	Coagulation factor 5/8 type
	IPR001791	195	376	PS50025	Laminin G
	IPR001791	381	560	PS50025	Laminin G
	IPR000742	562	599	PS50026	EGF-like
	IPR001791	807	971	PS50025	Laminin G
	IPR000742	972	1010	PS50026	EGF-like
	IPR001791	1031	1222	PS50025	Laminin G
ScanRegExp	IPR000421	81	110	PS01285	Coagulation factor 5/8 type
	IPR000421	171	189	PS01286	Coagulation factor 5/8 type
	IPR001545	971	977	PS00261	Gonadotropin

Prediction of transmembrane (TM) segments

Method	No.	N terminal	transmembrane region	C terminal	type	length
SOSUI2	1	14	RAGCGAALLLWIVSSCLCRAWTA	36	SECONDARY	23
SOSUI2	2	1270	AIIGGVIAVVIFTILCTLVFLIR	1292	PRIMARY	23

Primer_f	TAATCCAGGACAAGGCCAAGC
Primer_r	GGTCTCTGTGAAGTTGGGGTC
PCR conditions	95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

Panel name	UniGene
Primer_f	-
Primer_r	-
PCR product length	-
PCR conditions	-