Order Kazusa clone(s) from :
Japan
||
Other countries |
Product ID | ORK00123 |
---|---|
Accession No | AB018286 |
Description | neurexin 3, transcript variant 1 |
Clone name | hk04080 |
Vector information | |
cDNA sequence | DNA sequence (4149 bp) Predicted protein sequence (1205 aa) |
HaloTag ORF Clone |
FHC00123
|
Flexi ORF Clone | FXC00123 |
Source | Human adult brain |
Rouge ID |
mKIAA0743
by Kazusa Mouse cDNA Project
|
N-terminal truncation | Coding interruption | |
---|---|---|
cloned DNA seq | No warning | No warning |
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.Result of homology search against HUGE database (FASTA output, Multiple alignment)
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
Search method | interpro_ID | From | To | Entry | Definition |
---|---|---|---|---|---|
HMMPfam | IPR012680 | 58 | 184 | PF02210 | Laminin G |
IPR012680 | 246 | 390 | PF02210 | Laminin G | |
IPR006209 | 418 | 450 | PF00008 | EGF-like | |
IPR012680 | 484 | 614 | PF02210 | Laminin G | |
IPR012680 | 670 | 798 | PF02210 | Laminin G | |
IPR006209 | 824 | 856 | PF00008 | EGF-like | |
IPR012680 | 893 | 1012 | PF02210 | Laminin G | |
HMMSmart | IPR001791 | 50 | 184 | SM00282 | Laminin G |
IPR001791 | 238 | 390 | SM00282 | Laminin G | |
IPR006210 | 417 | 451 | SM00181 | EGF | |
IPR001791 | 476 | 614 | SM00282 | Laminin G | |
IPR001791 | 662 | 798 | SM00282 | Laminin G | |
IPR006210 | 823 | 857 | SM00181 | EGF | |
IPR001791 | 885 | 1012 | SM00282 | Laminin G | |
IPR003585 | 1151 | 1169 | SM00294 | Neurexin/syndecan/glycophorin C | |
ProfileScan | IPR001791 | 29 | 211 | PS50025 | Laminin G |
IPR001791 | 218 | 410 | PS50025 | Laminin G | |
IPR000742 | 414 | 451 | PS50026 | EGF-like | |
IPR001791 | 456 | 628 | PS50025 | Laminin G | |
IPR001791 | 642 | 817 | PS50025 | Laminin G | |
IPR000742 | 820 | 857 | PS50026 | EGF-like | |
IPR001791 | 861 | 1031 | PS50025 | Laminin G | |
ScanRegExp | IPR000152 | 429 | 440 | PS00010 | Aspartic acid and asparagine hydroxylation site |
Method | No. | N terminal | transmembrane region | C terminal | type | length | SOSUI2 | 1 | 1129 | TTGMVVGIVAAAALCILILLYA | 1150 | PRIMARY | 22 |
---|
RT-PCR-ELISA |
Primer_f | ACAAGGACAGGGAGTATTACG |
---|---|
Primer_r | CCCATTTCATAGTTCCAGCAG |
PCR conditions | 95 °C30 sec55 °C30 sec72 °C60 sec30 cycles |
Panel name | UniGene |
---|---|
Primer_f | - |
Primer_r | - |
PCR product length | - |
PCR conditions | - |