Order Kazusa clone(s) from : ![]() |
Product ID | ORK01134 |
---|---|
Accession No | AB020712 |
Description | SEC31 homolog A, COPII coat complex component, transcript variant 1 |
Clone name | hk10341 |
Vector information | |
cDNA sequence | DNA sequence (4110 bp) Predicted protein sequence (1229 aa) |
HaloTag ORF Clone |
FHC01134
![]() |
Flexi ORF Clone | FXC01134 |
Source | Human adult brain |
N-terminal truncation | Coding interruption | |
---|---|---|
cloned DNA seq | No warning | No warning |
Length of 3'UTR | 69 bp |
---|---|
Genome contig ID | gi89161207r_83859199 |
PolyA signal sequence (AAGAAA,-29) |
+----*----+----*----+----*----+---- |
Flanking genome sequence (99983 - 99934) |
----+----*----+----*----+----*----+----*----+----* |
Ensembl ContigView (Add our DAS server as a DAS source)
Chr | f/r | start | end | exon | identity | class | |
---|---|---|---|---|---|---|---|
| 4 | r | 83959182 | 84040715 | 29 | 99.8 | Perfect prediction |
![]() |
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
Search method | interpro_ID | From | To | Entry | Definition |
---|---|---|---|---|---|
HMMPfam | IPR001680 | 121 | 160 | PF00400 | WD40 repeat |
IPR001680 | 180 | 206 | PF00400 | WD40 repeat | |
IPR001680 | 259 | 294 | PF00400 | WD40 repeat | |
IPR001680 | 302 | 341 | PF00400 | WD40 repeat | |
HMMSmart | IPR001680 | 65 | 111 | SM00320 | WD40 repeat |
IPR001680 | 120 | 160 | SM00320 | WD40 repeat | |
IPR001680 | 167 | 206 | SM00320 | WD40 repeat | |
IPR001680 | 209 | 254 | SM00320 | WD40 repeat | |
IPR001680 | 258 | 298 | SM00320 | WD40 repeat | |
IPR001680 | 301 | 341 | SM00320 | WD40 repeat | |
ProfileScan | IPR001680 | 127 | 169 | PS50082 | WD40 repeat |
IPR001680 | 127 | 350 | PS50294 | WD40 repeat |
![]() |
Primer_f | GGATTGACCATGCATACCCAC |
---|---|
Primer_r | TATTGAGTGGAAGAGAAGCTG |
PCR conditions | 95 °C![]() ![]() ![]() ![]() ![]() ![]() ![]() |
Panel name | GeneBridge 4 |
---|---|
Primer_f | GGATTGACCATGCATACCCAC |
Primer_r | TATTGAGTGGAAGAGAAGCTG |
PCR product length | 137 bp |
PCR conditions | 95 °C![]() ![]() ![]() ![]() |