KIAA0905

Product ID	ORK01134
Accession No	AB020712
Description	SEC31 homolog A, COPII coat complex component, transcript variant 1
Clone name	hk10341
Vector information	The cDNA fragment was inserted at the SalI-NotI site of the ... The cDNA fragment was inserted at the SalI-NotI site of the pBluescript II SK(+) vector (GenBank Accession No. X52328, AmpR). The 5' end of the cDNA was repaired and ligated with the SalI adapter (5'TCGACCCACG CGTCCG3') and inserted at the SalI site of the vector. The 3'end of the cDNA was inserted at the NotI site of the vector.
cDNA sequence	DNA sequence (4110 bp) Predicted protein sequence (1229 aa)
HaloTag ORF Clone	FHC01134
Flexi ORF Clone	FXC01134
Source	Human adult brain

Length: 4110 bp

Physical map

Restriction map

Prediction of protein coding region (GeneMark analysis).

	N-terminal truncation	Coding interruption
cloned DNA seq	No warning	No warning

Integrity of 3' end

Length of 3'UTR	69 bp
Genome contig ID	gi89161207r_83859199
PolyA signal sequence (AAGAAA,-29)	+--------+--------+----*----+---- TTTCCAAAGAAACATGTTAAAAAAAAAAAAAAAAA
Flanking genome sequence (99983 - 99934)	----+--------+--------+--------+--------+----* GACATGGACTAGTCCTCATTAGCATGTTTGCATAGCAACCAGTCAAGAGC

Ensembl ContigView (Add our DAS server as a DAS source)

	Chr	f/r	start	end	exon	identity	class
Ensembl gnome browser	4	r	83959182	84040715	29	99.8	Perfect prediction

Length: 1229 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	ID%	Protein	Source
O94979	100.0	Protein transpo...	Homo sapiens
BAA84924	99.9	ABP130 [Homo sa...	Homo sapiens
XP_001139590	99.8	SEC31-like 1 [P...	Pan troglodytes
XP_001085017	99.3	similar to SEC3...	Macaca mulatta
XP_001140358	98.7	SEC31-like 1 [P...	Pan troglodytes

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against HUGE database (FASTA output, Multiple alignment)

No significant homologues

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method	interpro_ID	From	To	Entry	Definition
HMMPfam	IPR001680	121	160	PF00400	WD40 repeat
	IPR001680	180	206	PF00400	WD40 repeat
	IPR001680	259	294	PF00400	WD40 repeat
	IPR001680	302	341	PF00400	WD40 repeat
HMMSmart	IPR001680	65	111	SM00320	WD40 repeat
	IPR001680	120	160	SM00320	WD40 repeat
	IPR001680	167	206	SM00320	WD40 repeat
	IPR001680	209	254	SM00320	WD40 repeat
	IPR001680	258	298	SM00320	WD40 repeat
	IPR001680	301	341	SM00320	WD40 repeat
ProfileScan	IPR001680	127	169	PS50082	WD40 repeat
ProfileScan	IPR001680	127	350	PS50294	WD40 repeat

Primer_f	GGATTGACCATGCATACCCAC
Primer_r	TATTGAGTGGAAGAGAAGCTG
PCR conditions	95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

Panel name	GeneBridge 4
Primer_f	GGATTGACCATGCATACCCAC
Primer_r	TATTGAGTGGAAGAGAAGCTG
PCR product length	137 bp
PCR conditions	95 °C15 sec64 °C60 sec30 cycles