Gene/Protein Characteristic Table for KIAA0944
Order Kazusa clone(s) from : Japan || Other countries
Product ID ORK02006
Accession No AB023161
Description dynein, axonemal, heavy chain 7
Clone name hj04408s1
Vector information
The cDNA fragment was originally inserted at KpnI-NotI site ...
cDNA sequence DNA sequence (12418 bp)
Predicted protein sequence (4031 aa)
Flexi ORF Clone FXC02006
Source Human adult brain
Note We replaced hj04408, former representative clones for KIAA0944 with hj04408s1. (2002/12/27)
Features of the cloned cDNA sequence
Description

Length: 12418 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis).

N-terminal truncation Coding interruption
cloned DNA seq No warning No warning
Features of the protein sequence
Description

Length: 4031 aa
Result of homology search against nr database (FASTA output, Multiple alignment)
Entry Exp ID% Protein Source
BAG72531 0 100.0 dynein, axonema...
synthetic construct
EAW70121 0 100.0 dynein, axonema...
Homo sapiens
Q8WXX0 0 100.0 Dynein heavy ch...
Homo sapiens
NP_061720 0 99.9 dynein, axonema...
Homo sapiens
XP_515999 0 99.4 axonemal dynein...
Pan troglodytes
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
Result of homology search against HUGE database (FASTA output, Multiple alignment)
Entry Exp ID% HUGE_ID
AB037831 0 44.2 KIAA1410
AB046823 4.7e-169 35.0 KIAA1603
AB095937 1.2e-119 37.1 KIAA2017
AB040936 2.9e-100 38.2 KIAA1503
AB082528 1.8e-89 27.8 KIAA1997
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
Result of motif / domain search (InterProScan and SOSUI)

Result of InterProScan

Search method interpro_ID From To Entry Definition
HMMPfam IPR013602 761 1174 PF08393 Dynein heavy chain
IPR011704 1611 1762 PF07728 ATPase associated with various cellular activities
IPR011704 1978 2125 PF07728 ATPase associated with various cellular activities
IPR004273 3319 4028 PF03028 Dynein heavy chain
HMMSmart IPR003593 1327 1466 SM00382 AAA+ ATPase
IPR003593 1975 2123 SM00382 AAA+ ATPase
ProfileScan IPR002048 2247 2282 PS50222 Calcium-binding EF-hand
ScanRegExp IPR002048 2260 2272 PS00018 Calcium-binding EF-hand
IPR002198 3447 3475 PS00061 Short-chain dehydrogenase/reductase SDR
Expression profile
Description

RT-PCR-ELISA
Experimental conditions
Primer_f TCTGACCAACCCAAGGAACAC
Primer_r TCTACTCAGCCAGCCAACAAG
PCR conditions 95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

RH mapping information
Description

Chromosome No. 2
Experimental conditions
Panel name GeneBridge 4
Primer_f TCTGACCAACCCAAGGAACAC
Primer_r TCTACTCAGCCAGCCAACAAG
PCR product length 117 bp
PCR conditions 95 °C15 sec64 °C60 sec30 cycles
Order Kazusa clone(s) from : Japan || Other countries
Back to the HUGE Protein Database homepage
Send a message to office AT kazusa.or.jp