Order Kazusa clone(s) from : ![]() |
Product ID | ORK04848 |
---|---|
Accession No | AB082528 |
Description | dynein, cytoplasmic 2, heavy chain 1 |
Clone name | bj00195y1 |
Vector information | |
cDNA sequence | DNA sequence (5429 bp) Predicted protein sequence (1685 aa) |
Source | Human adult brain |
Rouge ID |
mKIAA1997
by Kazusa Mouse cDNA Project
|
Note | We replaced bj00195, former representative clones for KIAA1997 with bj00195y1. (2003/4/2) |
N-terminal truncation | Coding interruption | |
---|---|---|
cloned DNA seq | Warning | No warning |
Length of 3'UTR | 370 bp |
---|---|
Genome contig ID | gi51511727f_102475193 |
PolyA signal sequence (AATAAA,-21) |
+----*----+----*----+----*----+---- |
Flanking genome sequence (380370 - 380419) |
----+----*----+----*----+----*----+----*----+----* |
Ensembl ContigView (Add our DAS server as a DAS source)
Chr | f/r | start | end | exon | identity | class | |
---|---|---|---|---|---|---|---|
| 11 | f | 102575193 | 102855561 | 41 | 99.9 | Perfect prediction |
![]() |
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
![]() |
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
Primer_f | TCTCCTGTCCTCAATCTCTGG |
---|---|
Primer_r | GTTCCTCTGATGACTTTGCTG |
PCR conditions | 95 °C![]() ![]() ![]() ![]() ![]() ![]() ![]() |
Panel name | genbank |
---|---|
Primer_f | - |
Primer_r | - |
PCR product length | - |
PCR conditions | - |