KIAA0325

Product ID	ORK04846
Accession No	AB002323
Description	dynein, cytoplasmic 1, heavy chain 1
Clone name	hg00575y2
Vector information	The cDNA fragment was inserted at ApaI-NotI site of the pBlu ... The cDNA fragment was inserted at ApaI-NotI site of the pBluescript II SK(+) vector (GenBank Accession No.X52328, AmpR). The adjacent sequence to the 5' end of the cDNA is as follows: GGGCCCCCCC TCGAGGTCGA GGCCGCGAAT TCACTAGTGA TT-5' end of cDNA
cDNA sequence	DNA sequence (14205 bp) Predicted protein sequence (4658 aa)
HaloTag ORF Clone	FHC04846
Flexi ORF Clone	FXC04846
Source	Human adult brain
Rouge ID	mKIAA0325 by Kazusa Mouse cDNA Project
Note	We replaced hg00575 and hg00575y1, former representative clones for KIAA0325 with hg00575y2. (2003/4/2,2005/08/06)

Length: 14205 bp

Physical map

Restriction map

Prediction of protein coding region (GeneMark analysis).

	N-terminal truncation	Coding interruption
cloned DNA seq	Warning	No warning

Integrity of 3' end

Length of 3'UTR	228 bp
Genome contig ID	gi51511730f_101400746
PolyA signal sequence (AATAAA,-18)	+--------+--------+----*----+---- CGTGGCTCCTTTGAGGAAATAAAACACTAAGCATG
Flanking genome sequence (186137 - 186186)	----+--------+--------+--------+--------+----* AGCCGGCTCCGCCTCTTCTGTCTCCGCTTTCATCCCAGGGCACAGAGCCT

Ensembl ContigView (Add our DAS server as a DAS source)

	Chr	f/r	start	end	exon	identity	class
Ensembl gnome browser	14	f	101500746	101586881	78	100.0	Perfect prediction

Length: 4658 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	ID%	Protein	Source
Q14204	100.0	Cytoplasmic dyn...	Homo sapiens
XP_537556	99.2	similar to dyne...	Canis lupus fam...
XP_001491244	99.3	similar to dyne...	Equus caballus
NP_084514	99.2	cytoplasmic dyn...	Mus musculus
Q9JHU4	99.1	Cytoplasmic dyn...	Mus musculus

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against HUGE database (FASTA output, Multiple alignment)

Entry	Exp	ID%	HUGE_ID
AB082528	4.1e-75	28.3	KIAA1997
AB046823	5.5e-62	26.0	KIAA1603
AB040936	4.1e-44	26.2	KIAA1503
AB051484	8.5e-32	27.0	KIAA1697
AB095937	2.4e-25	29.7	KIAA2017

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method	interpro_ID	From	To	Entry	Definition
HMMPfam	IPR013594	250	846	PF08385	Dynein heavy chain
	IPR013602	1329	1737	PF08393	Dynein heavy chain
	IPR011704	2231	2379	PF07728	ATPase associated with various cellular activities
	IPR011704	2602	2751	PF07728	ATPase associated with various cellular activities
	IPR004273	3927	4657	PF03028	Dynein heavy chain
HMMSmart	IPR003593	1913	2057	SM00382	AAA+ ATPase
	IPR003593	2228	2379	SM00382	AAA+ ATPase
	IPR003593	2599	2749	SM00382	AAA+ ATPase
	IPR003593	2941	3107	SM00382	AAA+ ATPase
ScanRegExp	IPR000169	2228	2238	PS00639	Peptidase

Primer_f	GGCCTTCCCAAATACCTCCTG
Primer_r	GTGAAAAGAAAGTGGTTGGTC
PCR conditions	95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

Panel name	GeneBridge 4
Primer_f	GGCCTTCCCAAATACCTCCTG
Primer_r	GTGAAAAGAAAGTGGTTGGTC
PCR product length	103 bp
PCR conditions	95 °C15 sec64 °C60 sec30 cycles