Gene/Protein Characteristic Table for KIAA1697
Order Kazusa clone(s) from : Japan || Other countries
Product ID ORK04799
Accession No AB051484
Description dynein, axonemal, heavy chain 6
Clone name fj14406y2
Vector information
The cDNA fragment was inserted at ApaI-NotI site of the pBlu ...
cDNA sequence DNA sequence (6721 bp)
Predicted protein sequence (2182 aa)
Source Human fetal brain
Rouge ID mKIAA1697 by Kazusa Mouse cDNA Project
Note We replaced fj14406, former representative clones for KIAA1697 with fj14406y2. (2005/08/06)
Features of the cloned cDNA sequence
Description

Length: 6721 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis).

N-terminal truncation Coding interruption
cloned DNA seq Warning No warning
Integrity of 3' end
Length of 3'UTR 172 bp
Genome contig ID gi89161199f_84639660
PolyA signal sequence
(AATAAA,-22)
+----*----+----*----+----*----+----
CTTATGACCTTAAAATAAAGTGTTTGAGTTCTTTC
Flanking genome sequence
(260557 - 260606)
----+----*----+----*----+----*----+----*----+----*
TGTTGGCAATCCAAGCTCTGCTGTAGAAGCAGTGGGTTCAACAACCCACC

Ensembl ContigView (Add our DAS server as a DAS source)


Chr f/r start end exon identity class
Ensembl gnome browser 2 f 84739654 84900215 41 99.9 Terminal No-hit
Features of the protein sequence
Description

Length: 2182 aa
Result of homology search against nr database (FASTA output, Multiple alignment)
Entry Exp ID% Protein Source
BAG06719 0 100.0 DNAH6 variant p...
Homo sapiens
Q9C0G6 0 100.0 Dynein heavy ch...
Homo sapiens
XP_515578 0 98.8 similar to SI:z...
Pan troglodytes
XP_001082827 0 98.2 similar to Dyne...
Macaca mulatta
XP_001916921 0 93.6 similar to Dyne...
Equus caballus
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
Result of homology search against HUGE database (FASTA output, Multiple alignment)
Entry Exp ID% HUGE_ID
AB040936 1.2e-191 40.2 KIAA1503
AB095937 3e-164 34.4 KIAA2017
AB002355 4.7e-152 32.4 KIAA0357
AB023161 8.4e-88 41.7 KIAA0944
AB037831 7e-86 41.5 KIAA1410
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
Result of motif / domain search (InterProScan and SOSUI)

Result of InterProScan

Search method interpro_ID From To Entry Definition
HMMPfam IPR011704 115 262 PF07728 ATPase associated with various cellular activities
IPR004273 1512 2179 PF03028 Dynein heavy chain
HMMSmart IPR003593 112 265 SM00382 AAA+ ATPase
IPR003593 463 621 SM00382 AAA+ ATPase
Expression profile
Description

RT-PCR-ELISA
Experimental conditions
Primer_f TATTTTGCACCCATGGCTGAC
Primer_r GTAGATGACCTTGGCTGAACC
PCR conditions 95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

RH mapping information
Description

Chromosome No. 1
Experimental conditions
Panel name CCR
Primer_f TATTTTGCACCCATGGCTGAC
Primer_r GTAGATGACCTTGGCTGAACC
PCR product length 176 bp
PCR conditions 95 °C15 sec66 °C60 sec30 cycles
Order Kazusa clone(s) from : Japan || Other countries
Back to the HUGE Protein Database homepage
Send a message to office AT kazusa.or.jp