Order Kazusa clone(s) from : ![]() |
Product ID | ORK00693 |
---|---|
Accession No | AB023165 |
Description | transforming growth factor beta regulator 4, transcript variant 2 |
Clone name | hj05004 |
Vector information | |
cDNA sequence | DNA sequence (4432 bp) Predicted protein sequence (531 aa) |
HaloTag ORF Clone |
FHC00693
![]() |
Flexi ORF Clone | FXC00693 |
Source | Human adult brain |
Rouge ID |
mKIAA0948
by Kazusa Mouse cDNA Project
|
N-terminal truncation | Coding interruption | |
---|---|---|
cloned DNA seq | No warning | No warning |
![]() |
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
![]() |
Primer_f | ACAGAACAGAGAGTAGGACAG |
---|---|
Primer_r | TGGCCAAGCATCAGAGCAGTG |
PCR conditions | 95 °C![]() ![]() ![]() ![]() ![]() ![]() ![]() |
Panel name | UniGene |
---|---|
Primer_f | - |
Primer_r | - |
PCR product length | - |
PCR conditions | - |