KIAA0963

Product ID	ORK01617
Accession No	AB023180
Description	strawberry notch homolog 2 (Drosophila), transcript variant 1
Clone name	hj05936
Vector information	The cDNA fragment was inserted at the SalI-NotI site of the ... The cDNA fragment was inserted at the SalI-NotI site of the pBluescript II SK(+) vector (GenBank Accession No. X52328, AmpR). The 5' end of the cDNA was repaired and ligated with the SalI adapter (5'TCGACCCACG CGTCCG3') and inserted at the SalI site of the vector. The 3'end of the cDNA was inserted at the NotI site of the vector.
cDNA sequence	DNA sequence (4877 bp) Predicted protein sequence (1391 aa)
HaloTag ORF Clone	FHC01617
Flexi ORF Clone	FXC01617
Source	Human adult brain

Length: 4877 bp

Physical map

Restriction map

Prediction of protein coding region (GeneMark analysis).

	N-terminal truncation	Coding interruption
cloned DNA seq	No warning	Warning

Integrity of 3' end

Length of 3'UTR	561 bp
Genome contig ID	gi42406306r_958658
PolyA signal sequence (None)	+--------+--------+----*----+---- GTTCTGATGTACATATGTAAAGGACTTTTTTAAAT
Flanking genome sequence (100000 - 99951)	----+--------+--------+--------+--------+----* ATATGTGCCTTTTGCCTACTTCCCACGGAGTCTGCTCCTCAGCCTGTGGG

Ensembl ContigView (Add our DAS server as a DAS source)

	Chr	f/r	start	end	exon	identity	class
Ensembl gnome browser	19	r	1058658	1125259	32	99.6	Perfect prediction

Length: 1391 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	ID%	Protein	Source
BAG09919	100.0	strawberry notc...	synthetic construct
BAF85096	99.9	unnamed protein...	Homo sapiens
NP_001093592	97.8	strawberry notc...	Homo sapiens
BAG54153	97.7	unnamed protein...	Homo sapiens
A0JND4	85.8	Protein strawbe...	Bos taurus

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against HUGE database (FASTA output, Multiple alignment)

No significant homologues

Primer_f	ACCCTTGAAATCCGTGAAACC
Primer_r	GGTGAGCGGGCAATAACTTAG
PCR conditions	95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

Chromosome No. 19

Experimental conditions

Panel name	GeneBridge 4
Primer_f	ACCCTTGAAATCCGTGAAACC
Primer_r	GGTGAGCGGGCAATAACTTAG
PCR product length	167 bp
PCR conditions	95 °C15 sec64 °C60 sec30 cycles