KIAA1002

Product ID	ORK00163
Accession No	AB023219
Description	R3H domain containing 2
Clone name	hk09859
Vector information	The cDNA fragment was inserted at the SalI-NotI site of the ... The cDNA fragment was inserted at the SalI-NotI site of the pBluescript II SK(+) vector (GenBank Accession No. X52328, AmpR). The 5' end of the cDNA was repaired and ligated with the SalI adapter (5'TCGACCCACG CGTCCG3') and inserted at the SalI site of the vector. The 3'end of the cDNA was inserted at the NotI site of the vector.
cDNA sequence	DNA sequence (4331 bp) Predicted protein sequence (962 aa)
Flexi ORF Clone	FXC00163
Source	Human adult brain
Rouge ID	mKIAA1002 by Kazusa Mouse cDNA Project

Length: 4331 bp

Physical map

Restriction map

Prediction of protein coding region (GeneMark analysis).

	N-terminal truncation	Coding interruption
cloned DNA seq	No warning	No warning

Integrity of 3' end

Length of 3'UTR	1008 bp
Genome contig ID	gi89161190r_55833908
PolyA signal sequence (TATAAA,-25)	+--------+--------+----*----+---- TGTTTTTAAATATAAAAAAAAAAATCTGTCACTGG
Flanking genome sequence (99907 - 99858)	----+--------+--------+--------+--------+----* ACATCAGTCACTGTTTCTCTGTTGCCGCCCTGGTATGGGTAAAGGGTTGG

Ensembl ContigView (Add our DAS server as a DAS source)

	Chr	f/r	start	end	exon	identity	class
Ensembl gnome browser	12	r	55933815	56111055	24	99.6	Perfect prediction

Length: 962 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	Exp	ID%	Protein	Source
Q9Y2K5	0	99.7	R3H domain-cont...	Homo sapiens
XP_001488702	0	96.9	R3H domain cont...	Equus caballus
XP_001100250	0	99.6	hypothetical pr...	Macaca mulatta
BAG10408	0	100.0	R3H domain-cont...	synthetic construct
EAW97008	1.5e-206	100.0	R3H domain cont...	Homo sapiens

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against HUGE database (FASTA output, Multiple alignment)

Entry	Exp	ID%	HUGE_ID
D21852	8e-20	49.6	KIAA0029

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method	interpro_ID	From	To	Entry	Definition
HMMPfam	IPR001374	162	215	PF01424	Single-stranded nucleic acid binding R3H
HMMSmart	IPR001374	138	215	SM00393	Single-stranded nucleic acid binding R3H
ProfileScan	IPR001374	155	218	PS51061	Single-stranded nucleic acid binding R3H

Primer_f	TTCCCCATCTTGTCTTCCTAG
Primer_r	CAGTGAATATACCCAGCAAAC
PCR conditions	95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

Panel name	CCR
Primer_f	TTCCCCATCTTGTCTTCCTAG
Primer_r	CAGTGAATATACCCAGCAAAC
PCR product length	155 bp
PCR conditions	95 °C15 sec64 °C60 sec30 cycles