KIAA1019

Product ID	ORK06942
Accession No	AB028942
Description	SON DNA binding protein
Clone name	fg00188s1
Vector information	The cDNA fragment was inserted at the SalI-NotI site of the ... The cDNA fragment was inserted at the SalI-NotI site of the pBluescript II SK(+) vector (GenBank Accession No. X52328, AmpR). The 5' end of the cDNA was repaired and ligated with the SalI adapter (5'TCGACCCACG CGTCCG3') and inserted at the SalI site of the vector. The 3'end of the cDNA was inserted at the NotI site of the vector.
cDNA sequence	DNA sequence (7466 bp) Predicted protein sequence (2309 aa)
Source	Human fetal brain
Rouge ID	mKIAA1019 by Kazusa Mouse cDNA Project
Note	We replaced fg00188, former representative clones for KIAA1019 with fg00188s1. (2003/4/2)

Length: 7466 bp

Physical map

Restriction map

Prediction of protein coding region (GeneMark analysis).

	N-terminal truncation	Coding interruption
cloned DNA seq	No warning	No warning

Integrity of 3' end

Length of 3'UTR	530 bp
Genome contig ID	gi51511750f_33737245
PolyA signal sequence (AATAAA,-18)	+--------+--------+----*----+---- CCTTTGCTGTATCTTTTAATAAACAGTTTACTTTT
Flanking genome sequence (117594 - 117643)	----+--------+--------+--------+--------+----* ATTTAACTTGTTGTGCAAAATCACGCTTGGGGGATGTGGGAGGGTGGAGT

Ensembl ContigView (Add our DAS server as a DAS source)

	Chr	f/r	start	end	exon	identity	class
Ensembl gnome browser	21	f	33837245	33854837	7	99.2	Perfect prediction

Length: 2309 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	ID%	Protein	Source
NP_115571	99.9	SON DNA-binding...	Homo sapiens
AAL34498	99.9	SON DNA binding...	Homo sapiens
EAX09820	99.9	SON DNA binding...	Homo sapiens
XP_001165738	99.7	SON DNA-binding...	Pan troglodytes
NP_620305	99.9	SON DNA-binding...	Homo sapiens

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against HUGE database (FASTA output, Multiple alignment)

Entry	Exp	ID%	HUGE_ID
AB002322	2.7e-05	30.3	KIAA0324
AB011108	8.5e-05	33.4	KIAA0536

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method	interpro_ID	From	To	Entry	Definition
BlastProDom	IPR004829	388	445	PD153432	Cell surface antigen

Primer_f	ATCGAATTGCAGAGAACAGTG
Primer_r	TGTGTTGAACCTGAGGATCTG
PCR conditions	95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

Panel name	UniGene
Primer_f	-
Primer_r	-
PCR product length	-
PCR conditions	-