KIAA1022

Product ID	ORK06822
Accession No	AB028945
Description	SH3 and multiple ankyrin repeat domains 2
Clone name	fg00613
Vector information	The cDNA fragment was inserted at the SalI-NotI site of the ... The cDNA fragment was inserted at the SalI-NotI site of the pBluescript II SK(+) vector (GenBank Accession No. X52328, AmpR). The 5' end of the cDNA was repaired and ligated with the SalI adapter (5'TCGACCCACG CGTCCG3') and inserted at the SalI site of the vector. The 3'end of the cDNA was inserted at the NotI site of the vector.
cDNA sequence	DNA sequence (6830 bp) Predicted protein sequence (1131 aa)
Source	Human fetal brain
Rouge ID	mKIAA1022 by Kazusa Mouse cDNA Project

Length: 6830 bp

Physical map

Restriction map

Prediction of protein coding region (GeneMark analysis).

	N-terminal truncation	Coding interruption
cloned DNA seq	Warning	No warning

Integrity of 3' end

Length of 3'UTR	3434 bp
Genome contig ID	gi51511727r_69893188
PolyA signal sequence (AATAAA,-20)	+--------+--------+----*----+---- AAATTACTGTAAAAAAATAAATATACTATTGCACT
Flanking genome sequence (100000 - 99951)	----+--------+--------+--------+--------+----* AAGGTTGTGGTTCTGATTGCAAACAAACAGTGAACACTGTCTGAATTAAA

Ensembl ContigView (Add our DAS server as a DAS source)

	Chr	f/r	start	end	exon	identity	class
Ensembl gnome browser	11	r	69993188	70026612	7	99.3	Perfect prediction

Length: 1131 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	ID%	Protein	Source
Q9UPX8	100.0	SH3 and multipl...	Homo sapiens
AAI68372	100.0	SH3 and multipl...	synthetic construct
EAW74775	99.7	SH3 and multipl...	Homo sapiens
XP_001174048	99.4	SH3 and multipl...	Pan troglodytes
XP_001099919	98.7	similar to SH3 ...	Macaca mulatta

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against HUGE database (FASTA output, Multiple alignment)

Entry	Exp	ID%	HUGE_ID
AB051437	6.2e-12	35.6	KIAA1650

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method	interpro_ID	From	To	Entry	Definition
HMMPfam	IPR001660	1066	1129	PF00536	Sterile alpha motif SAM
HMMSmart	IPR001660	1065	1131	SM00454	Sterile alpha motif SAM
ProfileScan	IPR001660	1068	1131	PS50105	Sterile alpha motif SAM

Primer_f	ATCTCCTCCTGTGGTTTGCAT
Primer_r	TTGTGGAATCGTGACTTTGTG
PCR conditions	95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

Panel name	UniGene
Primer_f	-
Primer_r	-
PCR product length	-
PCR conditions	-