KIAA1650

Product ID	ORK06823
Accession No	AB051437
Description	SH3 and multiple ankyrin repeat domains 3
Clone name	hk02174
Vector information	The cDNA fragment was inserted at the SalI-NotI site of the ... The cDNA fragment was inserted at the SalI-NotI site of the pBluescript II SK(+) vector (GenBank Accession No. X52328, AmpR). The 5' end of the cDNA was repaired and ligated with the SalI adapter (5'TCGACCCACG CGTCCG3') and inserted at the SalI site of the vector. The 3'end of the cDNA was inserted at the NotI site of the vector.
cDNA sequence	DNA sequence (4293 bp) Predicted protein sequence (797 aa)
Source	Human adult brain
Rouge ID	mKIAA1650 by Kazusa Mouse cDNA Project

Length: 4293 bp

Physical map

Restriction map

Prediction of protein coding region (GeneMark analysis).

	N-terminal truncation	Coding interruption
cloned DNA seq	Warning	No warning

Integrity of 3' end

Length of 3'UTR	1898 bp
Genome contig ID	gi89161203f_49405929
PolyA signal sequence (AATAAA,-19)	+--------+--------+----*----+---- TATAATATTATTATGTAATAAATTTATAAGAAATG
Flanking genome sequence (112577 - 112626)	----+--------+--------+--------+--------+----* AAGCCATGGCTCAGTTGCCTGCTTGAGGGGATATTTGTGTCTGTCCCTCA

Ensembl ContigView (Add our DAS server as a DAS source)

	Chr	f/r	start	end	exon	identity	class
Ensembl gnome browser	22	f	49505929	49518504	2	99.4	Perfect prediction

Length: 797 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	ID%	Protein	Source
NP_001073889	100.0	SH3 and multipl...	Homo sapiens
BAG55459	98.9	SH3 and multipl...	Callithrix jacchus
BAB84864	100.0	FLJ00090 protei...	Homo sapiens
XP_589942	94.7	similar to prol...	Bos taurus
BAE16756	94.7	Shank3 [Mus mus...	Mus musculus

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against HUGE database (FASTA output, Multiple alignment)

Entry	Exp	ID%	HUGE_ID
AB028945	2.1e-11	35.7	KIAA1022

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method	interpro_ID	From	To	Entry	Definition
HMMPfam	IPR001660	732	795	PF00536	Sterile alpha motif SAM
HMMSmart	IPR001660	731	797	SM00454	Sterile alpha motif SAM
ProfileScan	IPR001660	734	797	PS50105	Sterile alpha motif SAM

Primer_f
Primer_r
PCR conditions	test

Panel name	genbank
Primer_f	-
Primer_r	-
PCR product length	-
PCR conditions	-