Gene/Protein Characteristic Table for KIAA1028
Order Kazusa clone(s) from : Japan || Other countries
Product ID ORK04502
Accession No AB028951
Description cyclin-dependent kinase 19
Clone name fh00176s1
Vector information
The cDNA fragment was inserted at the SalI-NotI site of the ...
cDNA sequence DNA sequence (6063 bp)
Predicted protein sequence (501 aa)
Source Human fetal brain
Rouge ID mKIAA1028 by Kazusa Mouse cDNA Project
Note We replaced fh00176, former representative clones for KIAA1028 with fh00176s1. (2002/5/10)
Features of the cloned cDNA sequence
Description

Length: 6063 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis).

N-terminal truncation Coding interruption
cloned DNA seq Warning No warning
Integrity of 3' end
Length of 3'UTR 4557 bp
Genome contig ID gi89161210r_110937874
PolyA signal sequence
(AATAAA,-21)
+----*----+----*----+----*----+----
ATATTCTTGGTTGAAATAAAATTTAATTGACTTTG
Flanking genome sequence
(100000 - 99951)
----+----*----+----*----+----*----+----*----+----*
CTTCTGTGTGGATTTTTTAAATATAAAAAAAATCTTATAATAAGGCTTAG

Ensembl ContigView (Add our DAS server as a DAS source)


Chr f/r start end exon identity class
Ensembl gnome browser 6 r 111037874 111243029 12 100.0 Internal No-hit
Features of the protein sequence
Description

Length: 501 aa
Result of homology search against nr database (FASTA output, Multiple alignment)
Entry Exp ID% Protein Source
Q9BWU1 5.9e-150 100.0 Cell division c...
Homo sapiens
BAF85049 1.5e-149 99.8 unnamed protein...
Homo sapiens
XP_589209 1.4e-146 98.2 similar to cell...
Bos taurus
Q8BWD8 4.6e-144 96.4 Cell division c...
Mus musculus
EDL87847 5.7e-144 96.4 cell division c...
Rattus norvegicus
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
Result of homology search against HUGE database (FASTA output, Multiple alignment)
Entry Exp ID% HUGE_ID
AB020711 2.5e-09 31.2 KIAA0904
AB020641 1.5e-07 33.5 KIAA0834
AB023153 2.2e-06 32.4 KIAA0936
AB018265 0.00031 24.9 KIAA0722
AB029024 0.00082 25.7 KIAA1101
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
Result of motif / domain search (InterProScan and SOSUI)

Result of InterProScan

Search method interpro_ID From To Entry Definition
BlastProDom IPR000719 27 239 PD000001 Protein kinase
HMMPfam IPR000719 19 334 PF00069 Protein kinase
HMMSmart IPR001245 20 332 SM00219 Tyrosine protein kinase
IPR002290 20 334 SM00220 Serine/threonine protein kinase
ProfileScan IPR000719 20 334 PS50011 Protein kinase
ScanRegExp IPR000719 26 51 PS00107 Protein kinase
IPR008271 146 158 PS00108 Serine/threonine protein kinase
Expression profile
Description

RT-PCR-ELISA
Experimental conditions
Primer_f ACTATGAGGCTGAAACAATCC
Primer_r CAAAAGAGTAGTGCAGAAGGC
PCR conditions 95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

RH mapping information
Description

Chromosome No. 6
Experimental conditions
Panel name GeneBridge 4
Primer_f ACTATGAGGCTGAAACAATCC
Primer_r CAAAAGAGTAGTGCAGAAGGC
PCR product length 139 bp
PCR conditions 95 °C15 sec62 °C60 sec30 cycles
Order Kazusa clone(s) from : Japan || Other countries
Back to the HUGE Protein Database homepage
Send a message to office AT kazusa.or.jp