KIAA1028

Product ID	ORK04502
Accession No	AB028951
Description	cyclin-dependent kinase 19
Clone name	fh00176s1
Vector information	The cDNA fragment was inserted at the SalI-NotI site of the ... The cDNA fragment was inserted at the SalI-NotI site of the pBluescript II SK(+) vector (GenBank Accession No. X52328, AmpR). The 5' end of the cDNA was repaired and ligated with the SalI adapter (5'TCGACCCACG CGTCCG3') and inserted at the SalI site of the vector. The 3'end of the cDNA was inserted at the NotI site of the vector.
cDNA sequence	DNA sequence (6063 bp) Predicted protein sequence (501 aa)
Source	Human fetal brain
Rouge ID	mKIAA1028 by Kazusa Mouse cDNA Project
Note	We replaced fh00176, former representative clones for KIAA1028 with fh00176s1. (2002/5/10)

Length: 6063 bp

Physical map

Restriction map

Prediction of protein coding region (GeneMark analysis).

	N-terminal truncation	Coding interruption
cloned DNA seq	Warning	No warning

Integrity of 3' end

Length of 3'UTR	4557 bp
Genome contig ID	gi89161210r_110937874
PolyA signal sequence (AATAAA,-21)	+--------+--------+----*----+---- ATATTCTTGGTTGAAATAAAATTTAATTGACTTTG
Flanking genome sequence (100000 - 99951)	----+--------+--------+--------+--------+----* CTTCTGTGTGGATTTTTTAAATATAAAAAAAATCTTATAATAAGGCTTAG

Ensembl ContigView (Add our DAS server as a DAS source)

	Chr	f/r	start	end	exon	identity	class
Ensembl gnome browser	6	r	111037874	111243029	12	100.0	Internal No-hit

Length: 501 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	Exp	ID%	Protein	Source
Q9BWU1	5.9e-150	100.0	Cell division c...	Homo sapiens
BAF85049	1.5e-149	99.8	unnamed protein...	Homo sapiens
XP_589209	1.4e-146	98.2	similar to cell...	Bos taurus
Q8BWD8	4.6e-144	96.4	Cell division c...	Mus musculus
EDL87847	5.7e-144	96.4	cell division c...	Rattus norvegicus

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against HUGE database (FASTA output, Multiple alignment)

Entry	Exp	ID%	HUGE_ID
AB020711	2.5e-09	31.2	KIAA0904
AB020641	1.5e-07	33.5	KIAA0834
AB023153	2.2e-06	32.4	KIAA0936
AB018265	0.00031	24.9	KIAA0722
AB029024	0.00082	25.7	KIAA1101

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method	interpro_ID	From	To	Entry	Definition
BlastProDom	IPR000719	27	239	PD000001	Protein kinase
HMMPfam	IPR000719	19	334	PF00069	Protein kinase
HMMSmart	IPR001245	20	332	SM00219	Tyrosine protein kinase
HMMSmart	IPR002290	20	334	SM00220	Serine/threonine protein kinase
ProfileScan	IPR000719	20	334	PS50011	Protein kinase
ScanRegExp	IPR000719	26	51	PS00107	Protein kinase
ScanRegExp	IPR008271	146	158	PS00108	Serine/threonine protein kinase

Primer_f	ACTATGAGGCTGAAACAATCC
Primer_r	CAAAAGAGTAGTGCAGAAGGC
PCR conditions	95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

Panel name	GeneBridge 4
Primer_f	ACTATGAGGCTGAAACAATCC
Primer_r	CAAAAGAGTAGTGCAGAAGGC
PCR product length	139 bp
PCR conditions	95 °C15 sec62 °C60 sec30 cycles