KIAA0834

Product ID	ORK00136
Accession No	AB020641
Description	cyclin-dependent kinase 14, transcript variant 2
Clone name	hj05353
Vector information	The cDNA fragment was inserted at the SalI-NotI site of the ... The cDNA fragment was inserted at the SalI-NotI site of the pBluescript II SK(+) vector (GenBank Accession No. X52328, AmpR). The 5' end of the cDNA was repaired and ligated with the SalI adapter (5'TCGACCCACG CGTCCG3') and inserted at the SalI site of the vector. The 3'end of the cDNA was inserted at the NotI site of the vector.
cDNA sequence	DNA sequence (4957 bp) Predicted protein sequence (453 aa)
HaloTag ORF Clone	FHC00136
Flexi ORF Clone	FXC00136
Source	Human adult brain
Rouge ID	mKIAA0834 by Kazusa Mouse cDNA Project

Length: 4957 bp

Physical map

Restriction map

Prediction of protein coding region (GeneMark analysis).

	N-terminal truncation	Coding interruption
cloned DNA seq	No warning	No warning

Integrity of 3' end

Length of 3'UTR	3457 bp
Genome contig ID	gi89161213f_90076648
PolyA signal sequence (AATAAA,-24)	+--------+--------+----*----+---- ACATGATATGGAATAAAGTATAGCAGAATCTCCGT
Flanking genome sequence (601194 - 601243)	----+--------+--------+--------+--------+----* ACATGTTCTAGGTACATCTTCTTGGTGGATGCCCAGTAAGAGCATATACC

Ensembl ContigView (Add our DAS server as a DAS source)

	Chr	f/r	start	end	exon	identity	class
Ensembl gnome browser	7	f	90176648	90677840	14	99.3	Perfect prediction

Length: 453 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	Exp	ID%	Protein	Source
ABY63621	6.1e-178	99.8	PFTAIRE protein...	Papio anubis
EAL24162	3.6e-177	100.0	PFTAIRE protein...	Homo sapiens
AAX41040	3.6e-177	100.0	PFTAIRE protein...	synthetic construct
EAW76872	3.8e-177	100.0	PFTAIRE protein...	Homo sapiens
ACA35057	7.3e-177	99.6	PFTAIRE protein...	Callicebus moloch

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against HUGE database (FASTA output, Multiple alignment)

Entry	Exp	ID%	HUGE_ID
AB023153	2.9e-27	37.4	KIAA0936
AB020711	7e-22	33.5	KIAA0904
AB033104	1.5e-19	33.3	KIAA1278
AB028951	8.2e-16	33.5	KIAA1028
AB058763	1.4e-14	30.0	KIAA1860

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method	interpro_ID	From	To	Entry	Definition
BlastProDom	IPR000719	119	322	PD000001	Protein kinase
HMMPfam	IPR000719	119	403	PF00069	Protein kinase
HMMSmart	IPR001245	119	403	SM00219	Tyrosine protein kinase
HMMSmart	IPR002290	119	403	SM00220	Serine/threonine protein kinase
ProfileScan	IPR000719	119	403	PS50011	Protein kinase
ScanRegExp	IPR000719	125	148	PS00107	Protein kinase
	IPR001199	204	211	PS00191	Cytochrome b5
	IPR008271	236	248	PS00108	Serine/threonine protein kinase

Primer_f	TCATTCCTTTTCCCACAGCAG
Primer_r	CAATCCCCTGTTAGAAAGTAC
PCR conditions	95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

Panel name	UniGene
Primer_f	-
Primer_r	-
PCR product length	-
PCR conditions	-