KIAA1860

Product ID	ORK00935
Accession No	AB058763
Description	MAP/microtubule affinity-regulating kinase 4, transcript variant 2
Clone name	fh18358
Vector information	The cDNA fragment was inserted at the SalI-NotI site of the ... The cDNA fragment was inserted at the SalI-NotI site of the pBluescript II SK(+) vector (GenBank Accession No. X52328, AmpR). The 5' end of the cDNA was repaired and ligated with the SalI adapter (5'TCGACCCACG CGTCCG3') and inserted at the SalI site of the vector. The 3'end of the cDNA was inserted at the NotI site of the vector.
cDNA sequence	DNA sequence (4917 bp) Predicted protein sequence (689 aa)
HaloTag ORF Clone	FHC00935
Flexi ORF Clone	FXC00935
Source	Human fetal brain
Rouge ID	mKIAA1860 by Kazusa Mouse cDNA Project

Length: 4917 bp

Physical map

Restriction map

Prediction of protein coding region (GeneMark analysis).

	N-terminal truncation	Coding interruption
cloned DNA seq	Warning	Warning

Integrity of 3' end

Length of 3'UTR	2845 bp
Genome contig ID	gi42406306f_50346682
PolyA signal sequence (AGTAAA,-18)	+--------+--------+----*----+---- TCAACTGGGGACAGTACAGTAAAGAACATCACAGC
Flanking genome sequence (153701 - 153750)	----+--------+--------+--------+--------+----* ATCTCACAGGTTCTGCATACCTTAATGTTTAGAATCTCTCCTAACCTTCC

Ensembl ContigView (Add our DAS server as a DAS source)

	Chr	f/r	start	end	exon	identity	class
Ensembl gnome browser	19	f	50446682	50500381	18	99.9	Perfect prediction

Length: 689 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	Exp	ID%	Protein	Source
EAW57334	0	100.0	MAP/microtubule...	Homo sapiens
BAB39380	0	99.9	MAP/microtubule...	Homo sapiens
Q96L34	1.6e-201	99.2	MAP/microtubule...	Homo sapiens
BAC03375	5.7e-201	99.1	microtubule aff...	Homo sapiens
XP_001057742	5.1e-198	97.2	similar to MAP/...	Rattus norvegicus

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against HUGE database (FASTA output, Multiple alignment)

Entry	Exp	ID%	HUGE_ID
AB040910	3.9e-41	54.9	KIAA1477
AB023216	6.8e-32	52.2	KIAA0999
AB018324	9.7e-30	55.8	KIAA0781
AB011109	1.3e-22	33.1	KIAA0537
D43636	5e-22	32.5	KIAA0096

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method	interpro_ID	From	To	Entry	Definition
BlastProDom	IPR000719	60	310	PD000001	Protein kinase
HMMPfam	IPR000719	60	311	PF00069	Protein kinase
HMMPfam	IPR000449	331	370	PF00627	Ubiquitin-associated/Translation elongation factor EF1B
HMMSmart	IPR001245	60	310	SM00219	Tyrosine protein kinase
	IPR002290	60	311	SM00220	Serine/threonine protein kinase
	IPR000449	332	369	SM00165	Ubiquitin-associated/Translation elongation factor EF1B
ProfileScan	IPR000719	60	311	PS50011	Protein kinase
ProfileScan	IPR000449	325	369	PS50030	Ubiquitin-associated/Translation elongation factor EF1B
ScanRegExp	IPR000719	66	89	PS00107	Protein kinase
ScanRegExp	IPR008271	178	190	PS00108	Serine/threonine protein kinase

Primer_f	GCGCAGATAGATTTAAGAGAG
Primer_r	AGTTGAAGATCCCAGCTCCAC
PCR conditions	95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

Panel name	unigene
Primer_f	-
Primer_r	-
PCR product length	-
PCR conditions	-