Gene/Protein Characteristic Table for KIAA0537
Order Kazusa clone(s) from : Japan || Other countries
Product ID ORK00556
Accession No AB011109
Description NUAK family, SNF1-like kinase, 1
Clone name hg03925
Vector information
The cDNA fragment was inserted at the SalI-NotI site of the ...
cDNA sequence DNA sequence (6828 bp)
Predicted protein sequence (698 aa)
Flexi ORF Clone FXC00556
Source Human adult brain
Rouge ID mKIAA0537 by Kazusa Mouse cDNA Project
Features of the cloned cDNA sequence
Description

Length: 6828 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis).

N-terminal truncation Coding interruption
cloned DNA seq No warning No warning
Features of the protein sequence
Description

Length: 698 aa
Result of homology search against nr database (FASTA output, Multiple alignment)
Entry Exp ID% Protein Source
O60285 0 100.0 NUAK family SNF...
Homo sapiens
XP_001161041 0 99.7 AMPK-related pr...
Pan troglodytes
XP_001098986 0 97.9 AMPK-related pr...
Macaca mulatta
XP_001789835 0 94.3 similar to NUAK...
Bos taurus
EDL21399 0 89.6 ZNUAK family, S...
Mus musculus
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
Result of homology search against HUGE database (FASTA output, Multiple alignment)
Entry Exp ID% HUGE_ID
AB058763 7.4e-32 33.3 KIAA1860
AB023216 1.2e-30 37.8 KIAA0999
AB018324 1e-26 42.4 KIAA0781
D79997 7.4e-24 31.1 KIAA0175
AB058714 1.5e-22 29.2 KIAA1811
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
Result of motif / domain search (InterProScan and SOSUI)

Result of InterProScan

Search method interpro_ID From To Entry Definition
BlastProDom IPR000719 92 342 PD000001 Protein kinase
HMMPfam IPR000719 92 343 PF00069 Protein kinase
HMMSmart IPR001245 92 341 SM00219 Tyrosine protein kinase
IPR002290 92 343 SM00220 Serine/threonine protein kinase
ProfileScan IPR000719 92 343 PS50011 Protein kinase
ScanRegExp IPR000719 98 125 PS00107 Protein kinase
IPR008271 211 223 PS00108 Serine/threonine protein kinase
Expression profile
Description

RT-PCR
Experimental conditions
Primer_f ATGCTAAGTACCCTCTGAATG
Primer_r GCAACAAGCAGTCAGTCGATC
PCR conditions 95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

RH mapping information
Description

Chromosome No. 12
Experimental conditions
Panel name GeneBridge 4
Primer_f ATGCTAAGTACCCTCTGAATG
Primer_r GCAACAAGCAGTCAGTCGATC
PCR product length 150 bp
PCR conditions 95 °C15 sec62 °C60 sec30 cycles
Order Kazusa clone(s) from : Japan || Other countries
Back to the HUGE Protein Database homepage
Send a message to office AT kazusa.or.jp