Order Kazusa clone(s) from : ![]() |
Product ID | ORK00556 |
---|---|
Accession No | AB011109 |
Description | NUAK family, SNF1-like kinase, 1 |
Clone name | hg03925 |
Vector information | |
cDNA sequence | DNA sequence (6828 bp) Predicted protein sequence (698 aa) |
HaloTag ORF Clone |
FHC00556
![]() |
Flexi ORF Clone | FXC00556 |
Source | Human adult brain |
Rouge ID |
mKIAA0537
by Kazusa Mouse cDNA Project
|
N-terminal truncation | Coding interruption | |
---|---|---|
cloned DNA seq | No warning | No warning |
![]() |
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
![]() |
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
Search method | interpro_ID | From | To | Entry | Definition |
---|---|---|---|---|---|
BlastProDom | IPR000719 | 92 | 342 | PD000001 | Protein kinase |
HMMPfam | IPR000719 | 92 | 343 | PF00069 | Protein kinase |
HMMSmart | IPR001245 | 92 | 341 | SM00219 | Tyrosine protein kinase |
IPR002290 | 92 | 343 | SM00220 | Serine/threonine protein kinase | |
ProfileScan | IPR000719 | 92 | 343 | PS50011 | Protein kinase |
ScanRegExp | IPR000719 | 98 | 125 | PS00107 | Protein kinase |
IPR008271 | 211 | 223 | PS00108 | Serine/threonine protein kinase |
![]() |
---|
Primer_f | ATGCTAAGTACCCTCTGAATG |
---|---|
Primer_r | GCAACAAGCAGTCAGTCGATC |
PCR conditions | 95 °C![]() ![]() ![]() ![]() ![]() ![]() ![]() |
Panel name | GeneBridge 4 |
---|---|
Primer_f | ATGCTAAGTACCCTCTGAATG |
Primer_r | GCAACAAGCAGTCAGTCGATC |
PCR product length | 150 bp |
PCR conditions | 95 °C![]() ![]() ![]() ![]() |