Order Kazusa clone(s) from : ![]() |
Product ID | ORK04289 |
---|---|
Accession No | AB058714 |
Description | BR serine/threonine kinase 1 |
Clone name | ha06731 |
Vector information | |
cDNA sequence | DNA sequence (2576 bp) Predicted protein sequence (715 aa) |
Source | Human adult brain |
N-terminal truncation | Coding interruption | |
---|---|---|
cloned DNA seq | Warning | No warning |
Length of 3'UTR | 427 bp |
---|---|
Genome contig ID | gi42406306f_60390239 |
PolyA signal sequence (None) |
+----*----+----*----+----*----+---- |
Flanking genome sequence (125438 - 125487) |
----+----*----+----*----+----*----+----*----+----* |
Ensembl ContigView (Add our DAS server as a DAS source)
Chr | f/r | start | end | exon | identity | class | |
---|---|---|---|---|---|---|---|
| 19 | f | 60490239 | 60515675 | 18 | 100.0 | Perfect prediction |
![]() |
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
![]() |
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
Search method | interpro_ID | From | To | Entry | Definition |
---|---|---|---|---|---|
BlastProDom | IPR000719 | 1 | 221 | PD000001 | Protein kinase |
HMMPfam | IPR000719 | 1 | 222 | PF00069 | Protein kinase |
HMMSmart | IPR001245 | 1 | 223 | SM00219 | Tyrosine protein kinase |
IPR002290 | 1 | 222 | SM00220 | Serine/threonine protein kinase | |
ProfileScan | IPR000719 | 1 | 222 | PS50011 | Protein kinase |
IPR000449 | 251 | 293 | PS50030 | Ubiquitin-associated/Translation elongation factor EF1B | |
ScanRegExp | IPR008271 | 89 | 101 | PS00108 | Serine/threonine protein kinase |
Method | No. | N terminal | transmembrane region | C terminal | type | length | SOSUI2 | 1 | 152 | WSCGVILFALLVGALPFDDDNLR | 174 | PRIMARY | 23 |
---|
![]() |
Primer_f | TCTCAACTCCATCCGCAACAG |
---|---|
Primer_r | GATGCTGCTGAGAGGTTTGTC |
PCR conditions | 95 °C![]() ![]() ![]() ![]() ![]() ![]() ![]() |
Panel name | genbank |
---|---|
Primer_f | - |
Primer_r | - |
PCR product length | - |
PCR conditions | - |