Order Kazusa clone(s) from : ![]() |
Product ID | ORK00236 |
---|---|
Accession No | AB040910 |
Description | MAP/microtubule affinity-regulating kinase 1, transcript variant 4 |
Clone name | fj04927 |
Vector information | |
cDNA sequence | DNA sequence (4638 bp) Predicted protein sequence (870 aa) |
HaloTag ORF Clone |
FHC00236
![]() |
Flexi ORF Clone | FXC00236 |
Source | Human fetal brain |
Rouge ID |
mKIAA1477
by Kazusa Mouse cDNA Project
|
N-terminal truncation | Coding interruption | |
---|---|---|
cloned DNA seq | No warning | No warning |
Length of 3'UTR | 1764 bp |
---|---|
Genome contig ID | gi89161185f_218668191 |
PolyA signal sequence (AATAAA,-26) |
+----*----+----*----+----*----+---- |
Flanking genome sequence (235706 - 235755) |
----+----*----+----*----+----*----+----*----+----* |
Ensembl ContigView (Add our DAS server as a DAS source)
Chr | f/r | start | end | exon | identity | class | |
---|---|---|---|---|---|---|---|
| 1 | f | 218768191 | 218903895 | 16 | 99.5 | Perfect prediction |
![]() |
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
![]() |
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
Search method | interpro_ID | From | To | Entry | Definition |
---|---|---|---|---|---|
BlastProDom | IPR000719 | 172 | 401 | PD000001 | Protein kinase |
HMMPfam | IPR000719 | 172 | 401 | PF00069 | Protein kinase |
IPR000449 | 421 | 460 | PF00627 | Ubiquitin-associated/Translation elongation factor EF1B | |
IPR001772 | 821 | 870 | PF02149 | Kinase-associated KA1 | |
HMMSmart | IPR001245 | 172 | 400 | SM00219 | Tyrosine protein kinase |
IPR002290 | 172 | 401 | SM00220 | Serine/threonine protein kinase | |
IPR000449 | 422 | 459 | SM00165 | Ubiquitin-associated/Translation elongation factor EF1B | |
ProfileScan | IPR000719 | 172 | 401 | PS50011 | Protein kinase |
IPR000449 | 415 | 460 | PS50030 | Ubiquitin-associated/Translation elongation factor EF1B | |
IPR001772 | 821 | 870 | PS50032 | Kinase-associated KA1 | |
ScanRegExp | IPR000719 | 178 | 201 | PS00107 | Protein kinase |
IPR008271 | 268 | 280 | PS00108 | Serine/threonine protein kinase |
![]() |
Primer_f | AAAGACCTCAGGCTAACAGTG |
---|---|
Primer_r | TATTCCTTCTTGCCATGCTAC |
PCR conditions | 95 °C![]() ![]() ![]() ![]() ![]() ![]() ![]() |
Panel name | GeneBridge 4 |
---|---|
Primer_f | CGAGCCAGGCAGTGATTTGAG |
Primer_r | GGTATGCGGACAGTAACGAGG |
PCR product length | 178 bp |
PCR conditions | 95 °C![]() ![]() ![]() ![]() |