KIAA0781

Product ID	ORK00636
Accession No	AB018324
Description	salt-inducible kinase 2
Clone name	hk09678
Vector information	The cDNA fragment was inserted at the SalI-NotI site of the ... The cDNA fragment was inserted at the SalI-NotI site of the pBluescript II SK(+) vector (GenBank Accession No. X52328, AmpR). The 5' end of the cDNA was repaired and ligated with the SalI adapter (5'TCGACCCACG CGTCCG3') and inserted at the SalI site of the vector. The 3'end of the cDNA was inserted at the NotI site of the vector.
cDNA sequence	DNA sequence (4160 bp) Predicted protein sequence (950 aa)
HaloTag ORF Clone	FHC00636
Flexi ORF Clone	FXC00636
Source	Human adult brain
Note	We replaced hk05370 and fj04126, former representative clones for KIAA0781 with hk09678. (2001/5/29,2002/5/10)

Length: 4160 bp

Physical map

Restriction map

Prediction of protein coding region (GeneMark analysis).

	N-terminal truncation	Coding interruption
cloned DNA seq	Warning	No warning

Integrity of 3' end

Length of 3'UTR	1305 bp
Genome contig ID	gi51511727f_110878424
PolyA signal sequence (AATAAA,-23)	+--------+--------+----*----+---- CATTATATTACTAATAAAACTTAACCAACACTTAC
Flanking genome sequence (222946 - 222995)	----+--------+--------+--------+--------+----* AATTCAGTCATCAAAGTAAGTAAAAATTAGATGCTACAGCTAGCTAACTG

Ensembl ContigView (Add our DAS server as a DAS source)

	Chr	f/r	start	end	exon	identity	class
Ensembl gnome browser	11	f	110978424	111101368	15	99.5	Perfect prediction

Length: 950 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	ID%	Protein	Source
Q9H0K1	100.0	Serine/threonin...	Homo sapiens
BAF83922	99.8	unnamed protein...	Homo sapiens
Q5REX1	98.9	Serine/threonin...	Pongo abelii
XP_508750	99.8	hypothetical pr...	Pan troglodytes
XP_001500093	93.6	SNF1-like kinas...	Equus caballus

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against HUGE database (FASTA output, Multiple alignment)

Entry	Exp	ID%	HUGE_ID
AB023216	4.8e-28	36.7	KIAA0999
AB058763	4.9e-20	55.8	KIAA1860
D43636	3.3e-15	34.2	KIAA0096
AB040910	9.6e-14	50.6	KIAA1477
AB058714	1.3e-13	30.8	KIAA1811

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method	interpro_ID	From	To	Entry	Definition
BlastProDom	IPR000719	49	295	PD000001	Protein kinase
HMMPfam	IPR000719	44	295	PF00069	Protein kinase
HMMSmart	IPR001245	44	295	SM00219	Tyrosine protein kinase
HMMSmart	IPR002290	44	295	SM00220	Serine/threonine protein kinase
ProfileScan	IPR000719	44	295	PS50011	Protein kinase
ProfileScan	IPR000449	319	359	PS50030	Ubiquitin-associated/Translation elongation factor EF1B
ScanRegExp	IPR000719	50	73	PS00107	Protein kinase
ScanRegExp	IPR008271	162	174	PS00108	Serine/threonine protein kinase

Prediction of transmembrane (TM) segments

Method	No.	N terminal	transmembrane region	C terminal	type	length
SOSUI2	1	222	LDIWSMGVVLYVLVCGALPFDGP	244	PRIMARY	23

Primer_f	CCTTATTCTCCACTCAACAGC
Primer_r	TAGACATCTTTGAGGTGAGCC
PCR conditions	95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

Panel name	UniGene
Primer_f	-
Primer_r	-
PCR product length	-
PCR conditions	-