Order Kazusa clone(s) from : ![]() |
Product ID | ORK00636 |
---|---|
Accession No | AB018324 |
Description | salt-inducible kinase 2 |
Clone name | hk09678 |
Vector information | |
cDNA sequence | DNA sequence (4160 bp) Predicted protein sequence (950 aa) |
Flexi ORF Clone | FXC00636 |
Source | Human adult brain |
Note | We replaced hk05370 and fj04126, former representative clones for KIAA0781 with hk09678. (2001/5/29,2002/5/10) |
N-terminal truncation | Coding interruption | |
---|---|---|
cloned DNA seq | Warning | No warning |
Length of 3'UTR | 1305 bp |
---|---|
Genome contig ID | gi51511727f_110878424 |
PolyA signal sequence (AATAAA,-23) |
+----*----+----*----+----*----+---- |
Flanking genome sequence (222946 - 222995) |
----+----*----+----*----+----*----+----*----+----* |
Ensembl ContigView (Add our DAS server as a DAS source)
Chr | f/r | start | end | exon | identity | class | |
---|---|---|---|---|---|---|---|
| 11 | f | 110978424 | 111101368 | 15 | 99.5 | Perfect prediction |
![]() |
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
![]() |
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
Search method | interpro_ID | From | To | Entry | Definition |
---|---|---|---|---|---|
BlastProDom | IPR000719 | 49 | 295 | PD000001 | Protein kinase |
HMMPfam | IPR000719 | 44 | 295 | PF00069 | Protein kinase |
HMMSmart | IPR001245 | 44 | 295 | SM00219 | Tyrosine protein kinase |
IPR002290 | 44 | 295 | SM00220 | Serine/threonine protein kinase | |
ProfileScan | IPR000719 | 44 | 295 | PS50011 | Protein kinase |
IPR000449 | 319 | 359 | PS50030 | Ubiquitin-associated/Translation elongation factor EF1B | |
ScanRegExp | IPR000719 | 50 | 73 | PS00107 | Protein kinase |
IPR008271 | 162 | 174 | PS00108 | Serine/threonine protein kinase |
Method | No. | N terminal | transmembrane region | C terminal | type | length |
---|---|---|---|---|---|---|
SOSUI2 | 1 | 222 | LDIWSMGVVLYVLVCGALPFDGP | 244 | PRIMARY | 23 |
![]() |
Primer_f | CCTTATTCTCCACTCAACAGC |
---|---|
Primer_r | TAGACATCTTTGAGGTGAGCC |
PCR conditions | 95 °C![]() ![]() ![]() ![]() ![]() ![]() ![]() |
Panel name | UniGene |
---|---|
Primer_f | - |
Primer_r | - |
PCR product length | - |
PCR conditions | - |