Order Kazusa clone(s) from :
Japan
||
Other countries |
Product ID | ORK06551 |
---|---|
Accession No | AB023216 |
Description | SIK family kinase 3 |
Clone name | fj10213 |
Vector information | |
cDNA sequence | DNA sequence (4460 bp) Predicted protein sequence (1371 aa) |
Source | Human fetal brain |
Rouge ID |
mKIAA0999
by Kazusa Mouse cDNA Project
|
Note | We replaced hk08707, former representative clones for KIAA0999 with fj10213. (2001/5/29) |
N-terminal truncation | Coding interruption | |
---|---|---|
cloned DNA seq | No warning | No warning |
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.Result of homology search against HUGE database (FASTA output, Multiple alignment)
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
Search method | interpro_ID | From | To | Entry | Definition |
---|---|---|---|---|---|
BlastProDom | IPR000719 | 116 | 367 | PD000001 | Protein kinase |
HMMPfam | IPR000719 | 116 | 367 | PF00069 | Protein kinase |
HMMSmart | IPR001245 | 116 | 367 | SM00219 | Tyrosine protein kinase |
IPR002290 | 116 | 367 | SM00220 | Serine/threonine protein kinase | |
ProfileScan | IPR000719 | 116 | 367 | PS50011 | Protein kinase |
IPR000449 | 394 | 434 | PS50030 | Ubiquitin-associated/Translation elongation factor EF1B | |
ScanRegExp | IPR000719 | 122 | 145 | PS00107 | Protein kinase |
IPR008271 | 234 | 246 | PS00108 | Serine/threonine protein kinase |
Method | No. | N terminal | transmembrane region | C terminal | type | length | SOSUI2 | 1 | 7 | VGTGARASAVAAVPSVSLLSGAS | 29 | SECONDARY | 23 | 2 | 31 | SSLAWCGLATGALGAGARGIPEL | 53 | SECONDARY | 23 | 3 | 295 | DIWSLGVVLYVLVCGALPFDGST | 317 | PRIMARY | 23 |
---|
RT-PCR-ELISA |
Primer_f | TCACCAACTACTCACCAGAAG |
---|---|
Primer_r | CAAGATGGCACGGTTAGTAGG |
PCR conditions | 95 °C30 sec55 °C30 sec72 °C60 sec30 cycles |
Panel name | GeneBridge 4 |
---|---|
Primer_f | TGACTTATCTGCGCTTGTTCC |
Primer_r | CAAGATGGCACGGTTAGTAGG |
PCR product length | 164 bp |
PCR conditions | 95 °C15 sec64 °C60 sec30 cycles |