Order Kazusa clone(s) from : ![]() |
Product ID | ORK00727 |
---|---|
Accession No | AB028982 |
Description | sortilin-related VPS10 domain containing receptor 3 |
Clone name | hh12158 |
Vector information | |
cDNA sequence | DNA sequence (5757 bp) Predicted protein sequence (1297 aa) |
HaloTag ORF Clone |
FHC00727
![]() |
Flexi ORF Clone | FXC00727 |
Source | Human adult brain |
N-terminal truncation | Coding interruption | |
---|---|---|
cloned DNA seq | Warning | No warning |
Length of 3'UTR | 1861 bp |
---|---|
Genome contig ID | gi89161187f_106290849 |
PolyA signal sequence (AATAAA,-22) |
+----*----+----*----+----*----+---- |
Flanking genome sequence (724136 - 724185) |
----+----*----+----*----+----*----+----*----+----* |
Ensembl ContigView (Add our DAS server as a DAS source)
Chr | f/r | start | end | exon | identity | class | |
---|---|---|---|---|---|---|---|
| 10 | f | 106390849 | 107014983 | 26 | 100.0 | Internal No-hit |
![]() |
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
Search method | interpro_ID | From | To | Entry | Definition |
---|---|---|---|---|---|
HMMPfam | IPR002860 | 306 | 317 | PF02012 | Glycoside hydrolase |
IPR002860 | 354 | 365 | PF02012 | Glycoside hydrolase | |
IPR002860 | 395 | 406 | PF02012 | Glycoside hydrolase | |
IPR002860 | 590 | 601 | PF02012 | Glycoside hydrolase | |
IPR002860 | 667 | 678 | PF02012 | Glycoside hydrolase | |
IPR002860 | 709 | 720 | PF02012 | Glycoside hydrolase | |
IPR000601 | 901 | 985 | PF00801 | PKD | |
HMMSmart | IPR006581 | 294 | 896 | SM00602 | VPS10 |
ProfileScan | IPR000601 | 935 | 979 | PS50093 | PKD |
Method | No. | N terminal | transmembrane region | C terminal | type | length | SOSUI2 | 1 | 1172 | LKPGVQVIVYVTQLTLAPLVDSS | 1194 | SECONDARY | 23 | 2 | 1200 | SAMLMLLSVVFVGLAVFLIYK | 1220 | PRIMARY | 21 |
---|
![]() |
Primer_f | GTTCCCATTCTTCTTTGTGAG |
---|---|
Primer_r | ATTGTCTGCCCCATTTAACCC |
PCR conditions | 95 °C![]() ![]() ![]() ![]() ![]() ![]() ![]() |
Panel name | GeneBridge 4 |
---|---|
Primer_f | GTTCCCATTCTTCTTTGTGAG |
Primer_r | ATTGTCTGCCCCATTTAACCC |
PCR product length | 132 bp |
PCR conditions | 95 °C![]() ![]() ![]() ![]() |