KIAA1329

Product ID	ORK06945
Accession No	AB037750
Description	sortilin-related VPS10 domain containing receptor 2
Clone name	fh14788
Vector information	The cDNA fragment was inserted at the SalI-NotI site of the ... The cDNA fragment was inserted at the SalI-NotI site of the pBluescript II SK(+) vector (GenBank Accession No. X52328, AmpR). The 5' end of the cDNA was repaired and ligated with the SalI adapter (5'TCGACCCACG CGTCCG3') and inserted at the SalI site of the vector. The 3'end of the cDNA was inserted at the NotI site of the vector.
cDNA sequence	DNA sequence (5287 bp) Predicted protein sequence (907 aa)
Source	Human fetal brain
Rouge ID	mKIAA1329 by Kazusa Mouse cDNA Project

Length: 5287 bp

Physical map

Restriction map

Prediction of protein coding region (GeneMark analysis).

	N-terminal truncation	Coding interruption
cloned DNA seq	Warning	No warning

Integrity of 3' end

Length of 3'UTR	2563 bp
Genome contig ID	gi89161207f_7591063
PolyA signal sequence (ATTAAA,-20)	+--------+--------+----*----+---- ATGCTTTTAACAAAGATTAAATGAATTTGATCAGC
Flanking genome sequence (204393 - 204442)	----+--------+--------+--------+--------+----* TTTTGCCTTATTGTGAAGATACTTTCCTCCTTTCCTGAAATGCATGTGGG

Ensembl ContigView (Add our DAS server as a DAS source)

	Chr	f/r	start	end	exon	identity	class
Ensembl gnome browser	4	f	7691063	7795454	24	99.4	Perfect prediction

Length: 907 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	ID%	Protein	Source
Q96PQ0	100.0	VPS10 domain-co...	Homo sapiens
AAI56054	99.9	Sortilin-relate...	synthetic construct
EAW82363	99.9	sortilin-relate...	Homo sapiens
BAG58506	98.4	unnamed protein...	Homo sapiens
XP_545903	90.5	similar to VPS1...	Canis lupus fam...

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against HUGE database (FASTA output, Multiple alignment)

Entry	Exp	ID%	HUGE_ID
AB028982	1.4e-160	45.0	KIAA1059

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method	interpro_ID	From	To	Entry	Definition
HMMPfam	IPR002860	21	32	PF02012	Glycoside hydrolase
	IPR002860	216	227	PF02012	Glycoside hydrolase
	IPR002860	293	304	PF02012	Glycoside hydrolase
	IPR002860	335	346	PF02012	Glycoside hydrolase
	IPR000601	535	617	PF00801	PKD
HMMSmart	IPR006581	1	528	SM00602	VPS10
HMMSmart	IPR000601	530	620	SM00089	PKD
ProfileScan	IPR000601	564	624	PS50093	PKD

Prediction of transmembrane (TM) segments

Method	No.	N terminal	transmembrane region	C terminal	type	length
SOSUI2	1	827	GYWAVVVLFVIGLFAAGAFILYK	849	PRIMARY	23

Primer_f	TTAAGGCAACATCAGCAAACC
Primer_r	AGGTTGTAGGTGTCCATCTGG
PCR conditions	95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

Panel name	unigene
Primer_f	-
Primer_r	-
PCR product length	-
PCR conditions	-