Gene/Protein Characteristic Table for KIAA1085
Order Kazusa clone(s) from : Japan || Other countries
Product ID ORK04876
Accession No AB029008
Description ankyrin repeat and KH domain containing 1
Clone name hj07690
Vector information
The cDNA fragment was inserted at the SalI-NotI site of the ...
cDNA sequence DNA sequence (5455 bp)
Predicted protein sequence (584 aa)
Source Human adult brain
Rouge ID mKIAA1085 by Kazusa Mouse cDNA Project
Features of the cloned cDNA sequence
Description

Length: 5455 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis).

N-terminal truncation Coding interruption
cloned DNA seq Warning Warning
Integrity of 3' end
Length of 3'UTR 3699 bp
Genome contig ID gi51511721f_139788595
PolyA signal sequence
(AGTAAA,-20)
+----*----+----*----+----*----+----
ACCTTCTGACTGCTTAGTAAACATTCAAAGAAATG
Flanking genome sequence
(120754 - 120803)
----+----*----+----*----+----*----+----*----+----*
CCTTGGCTCCAGTGTTCTCCTCAATGCTGATTTTCTCATCTCAGCCACAC

Ensembl ContigView (Add our DAS server as a DAS source)


Chr f/r start end exon identity class
Ensembl gnome browser 5 f 139888595 139909347 7 99.4 Perfect prediction
Features of the protein sequence
Description

Length: 584 aa
Result of homology search against nr database (FASTA output, Multiple alignment)
Entry Exp ID% Protein Source
CAB66877 4.8e-177 99.5 hypothetical pr...
Homo sapiens
EAW62060 5.3e-177 99.7 hCG1982388, iso...
Homo sapiens
XP_856763 9.7e-169 94.9 similar to mult...
Canis lupus fam...
XP_856682 9.7e-169 94.9 similar to mult...
Canis lupus fam...
XP_856640 1e-168 94.9 similar to mult...
Canis lupus fam...
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
Result of homology search against HUGE database (FASTA output, Multiple alignment)
Entry Exp ID% HUGE_ID
AB014597 2.7e-24 36.2 KIAA0697
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
Expression profile
Description

RT-PCR-ELISA
Experimental conditions
Primer_f TCATCTACGACCGAAAGTTCC
Primer_r AATTGTGCGTCATCGGGTATC
PCR conditions 95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

RH mapping information
Description

Chromosome No. 5
Experimental conditions
Panel name UniGene
Primer_f -
Primer_r -
PCR product length -
PCR conditions -
Order Kazusa clone(s) from : Japan || Other countries
Back to the HUGE Protein Database homepage
Send a message to office AT kazusa.or.jp