Gene/Protein Characteristic Table for KIAA0697
Order Kazusa clone(s) from : Japan || Other countries
Product ID ORK04107
Accession No AB014597
Description ankyrin repeat domain 17
Clone name hk04486s1
Vector information
The cDNA fragment was inserted at the SalI-NotI site of the ...
cDNA sequence DNA sequence (8456 bp)
Predicted protein sequence (2486 aa)
Source Human adult brain
Rouge ID mKIAA0697 by Kazusa Mouse cDNA Project
Note We replaced hk04486, former representative clones for KIAA0697 with hk04486s1. (2002/5/10)
Features of the cloned cDNA sequence
Description

Length: 8456 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis).

N-terminal truncation Coding interruption
cloned DNA seq Warning No warning
Integrity of 3' end
Length of 3'UTR 993 bp
Genome contig ID gi89161207r_74059819
PolyA signal sequence
(ATTAAA,-20)		 
+----*----+----*----+----*----+----
CTTAATATTCTGTTTATTAAATAATTCAATGTACT
Flanking genome sequence
(100000 - 99951)		 
----+----*----+----*----+----*----+----*----+----*
ATTTTATATTGGATGATATTGATTCTTAACATTGGCTTTTCAGTCATCAA

Ensembl ContigView (Add our DAS server as a DAS source)


Chr f/r start end exon identity class
Ensembl gnome browser 4 r 74159819 74342903 34 100.0 Perfect prediction
Features of the protein sequence
Description

Length: 2486 aa
Result of homology search against nr database (FASTA output, Multiple alignment)
Entry Exp ID% Protein Source
EAX05658 0 100.0 ankyrin repeat ...
 Homo sapiens
O75179 0 99.9 Ankyrin repeat ...
 Homo sapiens
XP_001157805 0 99.9 ankyrin repeat ...
 Pan troglodytes
XP_001157909 0 99.8 ankyrin repeat ...
 Pan troglodytes
XP_001157588 0 99.5 ankyrin repeat ...
 Pan troglodytes
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
Result of homology search against HUGE database (FASTA output, Multiple alignment)
Entry Exp ID% HUGE_ID
AB029008 1.2e-19 36.6 KIAA1085
AB033076 9.3e-09 32.4 KIAA1250
AB033049 1.1e-07 32.7 KIAA1223
AB002377 3.9e-06 26.6 KIAA0379
AB023174 0.0006 27.9 KIAA0957
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
Result of motif / domain search (InterProScan and SOSUI)

Result of InterProScan

Search method interpro_ID From To Entry Definition
FPrintScan IPR002110 999 1011 PR01415 Ankyrin
IPR002110 1011 1023 PR01415 Ankyrin
HMMPfam IPR002110 125 149 PF00023 Ankyrin
IPR002110 150 182 PF00023 Ankyrin
IPR002110 184 216 PF00023 Ankyrin
IPR002110 217 249 PF00023 Ankyrin
IPR002110 250 282 PF00023 Ankyrin
IPR002110 284 316 PF00023 Ankyrin
IPR002110 317 349 PF00023 Ankyrin
IPR002110 350 382 PF00023 Ankyrin
IPR002110 383 415 PF00023 Ankyrin
IPR002110 417 449 PF00023 Ankyrin
IPR002110 450 479 PF00023 Ankyrin
IPR002110 480 512 PF00023 Ankyrin
IPR002110 513 545 PF00023 Ankyrin
IPR002110 547 579 PF00023 Ankyrin
IPR002110 580 607 PF00023 Ankyrin
IPR000432 688 705 PF00488 DNA mismatch repair protein MutS
IPR002110 965 997 PF00023 Ankyrin
IPR002110 998 1030 PF00023 Ankyrin
IPR002110 1032 1064 PF00023 Ankyrin
IPR002110 1065 1097 PF00023 Ankyrin
IPR002110 1100 1132 PF00023 Ankyrin
IPR002110 1134 1166 PF00023 Ankyrin
IPR002110 1167 1199 PF00023 Ankyrin
IPR002110 1202 1234 PF00023 Ankyrin
IPR002110 1235 1267 PF00023 Ankyrin
IPR002110 1268 1290 PF00023 Ankyrin
IPR004088 1610 1672 PF00013 K Homology
HMMSmart IPR002110 117 146 SM00248 Ankyrin
IPR002110 150 179 SM00248 Ankyrin
IPR002110 184 213 SM00248 Ankyrin
IPR002110 217 246 SM00248 Ankyrin
IPR002110 250 279 SM00248 Ankyrin
IPR002110 284 313 SM00248 Ankyrin
IPR002110 317 346 SM00248 Ankyrin
IPR002110 350 379 SM00248 Ankyrin
IPR002110 383 412 SM00248 Ankyrin
IPR002110 417 446 SM00248 Ankyrin
IPR002110 447 476 SM00248 Ankyrin
IPR002110 480 509 SM00248 Ankyrin
IPR002110 513 542 SM00248 Ankyrin
IPR002110 547 576 SM00248 Ankyrin
IPR002110 580 609 SM00248 Ankyrin
IPR002110 965 994 SM00248 Ankyrin
IPR002110 998 1027 SM00248 Ankyrin
IPR002110 1032 1061 SM00248 Ankyrin
IPR002110 1065 1094 SM00248 Ankyrin
IPR002110 1100 1129 SM00248 Ankyrin
IPR002110 1134 1163 SM00248 Ankyrin
IPR002110 1167 1196 SM00248 Ankyrin
IPR002110 1202 1231 SM00248 Ankyrin
IPR002110 1235 1264 SM00248 Ankyrin
IPR002110 1268 1297 SM00248 Ankyrin
IPR004087 1607 1677 SM00322 K Homology
ProfileScan IPR002110 117 1290 PS50297 Ankyrin
IPR002110 184 216 PS50088 Ankyrin
IPR002110 217 249 PS50088 Ankyrin
IPR002110 250 282 PS50088 Ankyrin
IPR002110 284 316 PS50088 Ankyrin
IPR002110 317 349 PS50088 Ankyrin
IPR002110 350 382 PS50088 Ankyrin
IPR002110 383 415 PS50088 Ankyrin
IPR002110 447 479 PS50088 Ankyrin
IPR002110 480 512 PS50088 Ankyrin
IPR002110 513 545 PS50088 Ankyrin
IPR002110 547 579 PS50088 Ankyrin
IPR002110 965 997 PS50088 Ankyrin
IPR002110 998 1030 PS50088 Ankyrin
IPR002110 1032 1064 PS50088 Ankyrin
IPR002110 1065 1097 PS50088 Ankyrin
IPR002110 1100 1132 PS50088 Ankyrin
IPR002110 1134 1166 PS50088 Ankyrin
IPR002110 1167 1199 PS50088 Ankyrin
IPR002110 1202 1234 PS50088 Ankyrin
IPR002110 1235 1267 PS50088 Ankyrin
IPR004088 1608 1672 PS50084 K Homology
Expression profile
Description

RT-PCR
Experimental conditions
Primer_f TGGAGGAAATCACAAGTGGCC
Primer_r GGTAAAACGGATGATGATGGG
PCR conditions 95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

RH mapping information
Description

Chromosome No. 4
Experimental conditions
Panel name GeneBridge 4
Primer_f TGGAGGAAATCACAAGTGGCC
Primer_r GGTAAAACGGATGATGATGGG
PCR product length 162 bp
PCR conditions 95 °C15 sec64 °C60 sec30 cycles
Order Kazusa clone(s) from : Japan || Other countries
Back to the HUGE Protein Database homepage
Send a message to office AT kazusa.or.jp