KIAA1223

Product ID	ORK04113
Accession No	AB033049
Description	ankyrin repeat domain 50
Clone name	pg00513
Vector information	The cDNA fragment was inserted at the SalI-NotI site of the ... The cDNA fragment was inserted at the SalI-NotI site of the pBluescript II SK(+) vector (GenBank Accession No. X52328, AmpR). The 5' end of the cDNA was repaired and ligated with the SalI adapter (5'TCGACCCACG CGTCCG3') and inserted at the SalI site of the vector. The 3'end of the cDNA was inserted at the NotI site of the vector.
cDNA sequence	DNA sequence (6738 bp) Predicted protein sequence (1089 aa)
Source	Human brain (hippocampus)
Rouge ID	mKIAA1223 by Kazusa Mouse cDNA Project
Note	We replaced fh03861, former representative clones for KIAA1223 with pg00513. (2005/08/06)

Length: 6738 bp

Physical map

Restriction map

Prediction of protein coding region (GeneMark analysis).

	N-terminal truncation	Coding interruption
cloned DNA seq	Warning	No warning

Integrity of 3' end

Length of 3'UTR	3466 bp
Genome contig ID	gi89161207r_125704657
PolyA signal sequence (AATAAA,-28)	+--------+--------+----*----+---- TTTTCTAAATAAAATTTGTGTGTTTCTTCACTCAG
Flanking genome sequence (100000 - 99951)	----+--------+--------+--------+--------+----* TAAACTTGCGTCACTTCTTCATGACCTCTTTCCCCACCAGAACACAGCAT

Ensembl ContigView (Add our DAS server as a DAS source)

	Chr	f/r	start	end	exon	identity	class
Ensembl gnome browser	4	r	125804657	125812863	2	99.5	Perfect prediction

Length: 1089 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	ID%	Protein	Source
EAX05206	99.9	ankyrin repeat ...	Homo sapiens
CAE45806	99.9	hypothetical pr...	Homo sapiens
Q9ULJ7	99.9	Ankyrin repeat ...	Homo sapiens
NP_065070	99.9	ankyrin repeat ...	Homo sapiens
BAG58158	99.8	unnamed protein...	Homo sapiens

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against HUGE database (FASTA output, Multiple alignment)

Entry	Exp	ID%	HUGE_ID
AB002377	3.9e-16	32.8	KIAA0379
AB051515	1.2e-15	25.0	KIAA1728
AB033076	1.4e-15	34.7	KIAA1250
AB014597	1.4e-14	32.7	KIAA0697
AB046856	4.1e-12	25.6	KIAA1636

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method	interpro_ID	From	To	Entry	Definition
FPrintScan	IPR002110	507	519	PR01415	Ankyrin
FPrintScan	IPR002110	717	729	PR01415	Ankyrin
HMMPfam	IPR002110	155	172	PF00023	Ankyrin
	IPR002110	184	203	PF00023	Ankyrin
	IPR002110	204	236	PF00023	Ankyrin
	IPR002110	237	269	PF00023	Ankyrin
	IPR002110	270	302	PF00023	Ankyrin
	IPR002110	303	335	PF00023	Ankyrin
	IPR002110	336	368	PF00023	Ankyrin
	IPR002110	369	406	PF00023	Ankyrin
	IPR002110	407	439	PF00023	Ankyrin
	IPR002110	440	472	PF00023	Ankyrin
	IPR002110	473	505	PF00023	Ankyrin
	IPR002110	506	538	PF00023	Ankyrin
	IPR002110	539	571	PF00023	Ankyrin
	IPR002110	572	604	PF00023	Ankyrin
	IPR002110	605	637	PF00023	Ankyrin
	IPR002110	638	670	PF00023	Ankyrin
	IPR002110	671	703	PF00023	Ankyrin
	IPR002110	704	736	PF00023	Ankyrin
	IPR002110	737	763	PF00023	Ankyrin
HMMSmart	IPR002110	204	233	SM00248	Ankyrin
	IPR002110	237	266	SM00248	Ankyrin
	IPR002110	270	299	SM00248	Ankyrin
	IPR002110	303	332	SM00248	Ankyrin
	IPR002110	336	365	SM00248	Ankyrin
	IPR002110	369	403	SM00248	Ankyrin
	IPR002110	407	436	SM00248	Ankyrin
	IPR002110	440	469	SM00248	Ankyrin
	IPR002110	473	502	SM00248	Ankyrin
	IPR002110	506	535	SM00248	Ankyrin
	IPR002110	539	568	SM00248	Ankyrin
	IPR002110	572	601	SM00248	Ankyrin
	IPR002110	605	634	SM00248	Ankyrin
	IPR002110	638	667	SM00248	Ankyrin
	IPR002110	671	700	SM00248	Ankyrin
	IPR002110	704	733	SM00248	Ankyrin
	IPR002110	737	767	SM00248	Ankyrin
ProfileScan	IPR002110	155	763	PS50297	Ankyrin
	IPR002110	204	236	PS50088	Ankyrin
	IPR002110	237	269	PS50088	Ankyrin
	IPR002110	270	302	PS50088	Ankyrin
	IPR002110	303	335	PS50088	Ankyrin
	IPR002110	336	368	PS50088	Ankyrin
	IPR002110	369	406	PS50088	Ankyrin
	IPR002110	407	439	PS50088	Ankyrin
	IPR002110	440	472	PS50088	Ankyrin
	IPR002110	473	505	PS50088	Ankyrin
	IPR002110	506	538	PS50088	Ankyrin
	IPR002110	539	571	PS50088	Ankyrin
	IPR002110	572	604	PS50088	Ankyrin
	IPR002110	605	637	PS50088	Ankyrin
	IPR002110	638	670	PS50088	Ankyrin
	IPR002110	671	703	PS50088	Ankyrin
	IPR002110	704	736	PS50088	Ankyrin
	IPR002110	737	763	PS50088	Ankyrin

Primer_f	CAAAAGTAAGTATTCCTCGGG
Primer_r	ATAAGCAAGGCAGGGCATCTC
PCR conditions	95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

Panel name	GeneBridge 4
Primer_f	CAAAAGTAAGTATTCCTCGGG
Primer_r	ATAAGCAAGGCAGGGCATCTC
PCR product length	120 bp
PCR conditions	95 °C15 sec62 °C60 sec30 cycles