KIAA1728

Product ID	ORK07057
Accession No	AB051515
Description	tetratricopeptide repeat, ankyrin repeat and coiled-coil containing 1
Clone name	pg00239
Vector information	The cDNA fragment was inserted at the SalI-NotI site of the ... The cDNA fragment was inserted at the SalI-NotI site of the pBluescript II SK(+) vector (GenBank Accession No. X52328, AmpR). The 5' end of the cDNA was repaired and ligated with the SalI adapter (5'TCGACCCACG CGTCCG3') and inserted at the SalI site of the vector. The 3'end of the cDNA was inserted at the NotI site of the vector.
cDNA sequence	DNA sequence (6585 bp) Predicted protein sequence (1644 aa)
Source	Human brain (hippocampus)
Rouge ID	mKIAA1728 by Kazusa Mouse cDNA Project

Length: 6585 bp

Physical map

Restriction map

Prediction of protein coding region (GeneMark analysis).

	N-terminal truncation	Coding interruption
cloned DNA seq	Warning	No warning

Integrity of 3' end

Length of 3'UTR	1648 bp
Genome contig ID	gi89161199f_159628038
PolyA signal sequence (AATAAA,-18)	+--------+--------+----*----+---- TGTACTTTTCCATATGGAATAAAGACTATTAATAG
Flanking genome sequence (169378 - 169427)	----+--------+--------+--------+--------+----* AATGTGTTTTGCACTAAATGAGTCAATGGATAAGTAGAGAACAGCCTGAT

Ensembl ContigView (Add our DAS server as a DAS source)

	Chr	f/r	start	end	exon	identity	class
Ensembl gnome browser	2	f	159715281	159797414	21	99.4	Perfect prediction

Length: 1644 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	ID%	Protein	Source
EAX11418	99.9	tetratricopepti...	Homo sapiens
Q9C0D5	99.9	Protein TANC1; ...	Homo sapiens
XP_001093114	97.5	similar to TPR ...	Macaca mulatta
XP_001093218	97.5	similar to TPR ...	Macaca mulatta
XP_001492440	91.9	tetratricopepti...	Equus caballus

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against HUGE database (FASTA output, Multiple alignment)

Entry	Exp	ID%	HUGE_ID
AB046856	9.4e-172	52.4	KIAA1636
AB033049	5e-15	25.9	KIAA1223
AB033076	2.2e-08	30.0	KIAA1250
AB002377	9.8e-07	33.0	KIAA0379
AB037755	5.5e-06	29.7	KIAA1334

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method	interpro_ID	From	To	Entry	Definition
FPrintScan	IPR002110	928	940	PR01415	Ankyrin
FPrintScan	IPR002110	940	952	PR01415	Ankyrin
HMMPfam	IPR002110	685	714	PF00023	Ankyrin
	IPR002110	726	749	PF00023	Ankyrin
	IPR002110	750	782	PF00023	Ankyrin
	IPR002110	783	806	PF00023	Ankyrin
	IPR002110	827	859	PF00023	Ankyrin
	IPR002110	861	893	PF00023	Ankyrin
	IPR002110	894	926	PF00023	Ankyrin
	IPR002110	927	959	PF00023	Ankyrin
	IPR002110	960	992	PF00023	Ankyrin
	IPR002110	993	1025	PF00023	Ankyrin
	IPR002110	1026	1058	PF00023	Ankyrin
	IPR001440	1119	1152	PF00515	Tetratricopeptide TPR_1
	IPR013105	1153	1186	PF07719	Tetratricopeptide TPR_2
HMMSmart	IPR002110	679	711	SM00248	Ankyrin
	IPR002110	715	746	SM00248	Ankyrin
	IPR002110	750	779	SM00248	Ankyrin
	IPR002110	823	852	SM00248	Ankyrin
	IPR002110	861	890	SM00248	Ankyrin
	IPR002110	894	923	SM00248	Ankyrin
	IPR002110	927	956	SM00248	Ankyrin
	IPR002110	960	989	SM00248	Ankyrin
	IPR002110	993	1022	SM00248	Ankyrin
	IPR002110	1026	1055	SM00248	Ankyrin
	IPR013026	1072	1105	SM00028	Tetratricopeptide region
	IPR013026	1119	1152	SM00028	Tetratricopeptide region
	IPR013026	1153	1186	SM00028	Tetratricopeptide region
ProfileScan	IPR002110	679	1053	PS50297	Ankyrin
	IPR002110	750	782	PS50088	Ankyrin
	IPR002110	861	893	PS50088	Ankyrin
	IPR002110	894	926	PS50088	Ankyrin
	IPR002110	927	959	PS50088	Ankyrin
	IPR002110	960	992	PS50088	Ankyrin
	IPR002110	993	1025	PS50088	Ankyrin
	IPR013026	1072	1105	PS50005	Tetratricopeptide region
	IPR013026	1072	1186	PS50293	Tetratricopeptide region
	IPR013026	1119	1152	PS50005	Tetratricopeptide region
	IPR013026	1153	1186	PS50005	Tetratricopeptide region

Primer_f	TCATCTGTCCCTTCCTCATAC
Primer_r	CTGGCTGGTTTTCACGATCTG
PCR conditions	95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

Panel name	CCR
Primer_f	TCATCTGTCCCTTCCTCATAC
Primer_r	CTGGCTGGTTTTCACGATCTG
PCR product length	174 bp
PCR conditions	95 °C15 sec64 °C60 sec30 cycles