Order Kazusa clone(s) from :
Japan
||
Other countries |
Product ID | ORK04253 |
---|---|
Accession No | AB029019 |
Description | proline-rich coiled-coil 2C |
Clone name | pf00402 |
Vector information | |
cDNA sequence | DNA sequence (7421 bp) Predicted protein sequence (1919 aa) |
Source | Human brain (hippocampus) |
Rouge ID |
mKIAA1096
by Kazusa Mouse cDNA Project
|
Note | We replaced hk06861, former representative clones for KIAA1096 with pf00402. (2002/5/10) |
N-terminal truncation | Coding interruption | |
---|---|---|
cloned DNA seq | Warning | Warning |
Length of 3'UTR | 1659 bp |
---|---|
Genome contig ID | gi89161185f_169676024 |
PolyA signal sequence (AATAAA,-19) |
+----*----+----*----+----*----+---- |
Flanking genome sequence (153246 - 153295) |
----+----*----+----*----+----*----+----*----+----* |
Ensembl ContigView (Add our DAS server as a DAS source)
Chr | f/r | start | end | exon | identity | class | |
---|---|---|---|---|---|---|---|
| 1 | f | 169776024 | 169829268 | 21 | 99.3 | Perfect prediction |
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.Result of homology search against HUGE database (FASTA output, Multiple alignment)
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
RT-PCR-ELISA |
Primer_f | TGTGTTGAGTTGGCATTGTAC |
---|---|
Primer_r | CAAACCCATGTAGATAAGACC |
PCR conditions | 95 °C30 sec55 °C30 sec72 °C60 sec30 cycles |
Panel name | UniGene |
---|---|
Primer_f | - |
Primer_r | - |
PCR product length | - |
PCR conditions | - |