KIAA1096

Product ID	ORK04253
Accession No	AB029019
Description	proline-rich coiled-coil 2C
Clone name	pf00402
Vector information	The cDNA fragment was inserted at the SalI-NotI site of the ... The cDNA fragment was inserted at the SalI-NotI site of the pBluescript II SK(+) vector (GenBank Accession No. X52328, AmpR). The 5' end of the cDNA was repaired and ligated with the SalI adapter (5'TCGACCCACG CGTCCG3') and inserted at the SalI site of the vector. The 3'end of the cDNA was inserted at the NotI site of the vector.
cDNA sequence	DNA sequence (7421 bp) Predicted protein sequence (1919 aa)
Source	Human brain (hippocampus)
Rouge ID	mKIAA1096 by Kazusa Mouse cDNA Project
Note	We replaced hk06861, former representative clones for KIAA1096 with pf00402. (2002/5/10)

Length: 7421 bp

Physical map

Restriction map

Prediction of protein coding region (GeneMark analysis).

	N-terminal truncation	Coding interruption
cloned DNA seq	Warning	Warning

Integrity of 3' end

Length of 3'UTR	1659 bp
Genome contig ID	gi89161185f_169676024
PolyA signal sequence (AATAAA,-19)	+--------+--------+----*----+---- TTTGATTACAGAAACTAATAAAGTATTCTCTAAAT
Flanking genome sequence (153246 - 153295)	----+--------+--------+--------+--------+----* AATGATTCTTGGAGCTTATAATCATTTCCTAAAATCTGAAGCAAGAGGGT

Ensembl ContigView (Add our DAS server as a DAS source)

	Chr	f/r	start	end	exon	identity	class
Ensembl gnome browser	1	f	169776024	169829268	21	99.3	Perfect prediction

Length: 1919 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	ID%	Protein	Source
XP_001145208	99.5	HBxAg transacti...	Pan troglodytes
XP_001099397	98.1	similar to HBxA...	Macaca mulatta
XP_862019	90.3	similar to HBxA...	Canis lupus fam...
XP_537196	90.3	similar to HBxA...	Canis lupus fam...
Q9Y520	97.5	BAT2 domain-con...	Homo sapiens

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against HUGE database (FASTA output, Multiple alignment)

Entry	Exp	ID%	HUGE_ID
AB011087	2.8e-05	31.0	KIAA0515
AB002322	0.00014	21.5	KIAA0324

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Primer_f	TGTGTTGAGTTGGCATTGTAC
Primer_r	CAAACCCATGTAGATAAGACC
PCR conditions	95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

Panel name	UniGene
Primer_f	-
Primer_r	-
PCR product length	-
PCR conditions	-