KIAA1102

Product ID	ORK05830
Accession No	AB029025
Description	LIM and calponin homology domains 1
Clone name	bh00035
Vector information	The cDNA fragment was inserted at the XhoI-SacI site of the ... The cDNA fragment was inserted at the XhoI-SacI site of the pBC SK+ vector(Cm resistance; http://www.kazusa.or.jp/huge/vectorinfo/pbcskp_s.txt) with sequences including attB1 and attB2 sites (CTCGAGCAGC TGAAGCTTTC ACAAGTTTGT ACAAAAAAGC AGGCTCTTC-5' end of cDNA, GAGCTCTCAC CACTTTGTAC AAGAAAGCTG GGCGGCCGCT TTTTTTTTTT TTTTTTT-3' end of cDNA).
cDNA sequence	DNA sequence (5113 bp) Predicted protein sequence (1101 aa)
Source	Human adult brain
Rouge ID	mKIAA1102 by Kazusa Mouse cDNA Project
Note	We replaced hk10140, former representative clones for KIAA1102 with bh00035. (2002/5/10)

Length: 5113 bp

Physical map

Restriction map

Prediction of protein coding region (GeneMark analysis).

	N-terminal truncation	Coding interruption
cloned DNA seq	Warning	No warning

Integrity of 3' end

Length of 3'UTR	1807 bp
Genome contig ID	gi89161207f_40957561
PolyA signal sequence (AATAAA,-11)	+--------+--------+----*----+---- TGCTGTTTTACAGGAAAAAATAAAAATAAAAAAAG
Flanking genome sequence (438208 - 438257)	----+--------+--------+--------+--------+----* AAAAAAAGAAAAAATTAAAAAGAAAAATTGTTTTGAAAATGTACAGATCA

Ensembl ContigView (Add our DAS server as a DAS source)

	Chr	f/r	start	end	exon	identity	class
Ensembl gnome browser	4	f	41057561	41395767	25	99.6	Internal No-hit

Length: 1101 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	ID%	Protein	Source
Q9UPQ0	100.0	LIM and calponi...	Homo sapiens
EAW92984	99.9	hypothetical pr...	Homo sapiens
EAW92988	99.8	hypothetical pr...	Homo sapiens
NP_001106188	97.5	LIM and calponi...	Homo sapiens
CAI45946	97.4	hypothetical pr...	Homo sapiens

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against HUGE database (FASTA output, Multiple alignment)

Entry	Exp	ID%	HUGE_ID
AB020665	5.7e-22	28.9	KIAA0858

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method	interpro_ID	From	To	Entry	Definition
BlastProDom	IPR003247	69	108	PD001527	Calponin-like actin-binding subtype
BlastProDom	IPR001781	1031	1089	PD000094	Zinc finger
FPrintScan	IPR001997	43	57	PR00889	Calponin
	IPR003096	62	77	PR00888	SM22/calponin
	IPR001997	73	90	PR00889	Calponin
	IPR003096	95	111	PR00888	SM22/calponin
	IPR003096	111	126	PR00888	SM22/calponin
HMMPfam	IPR001715	40	156	PF00307	Calponin-like actin-binding
HMMPfam	IPR001781	1031	1094	PF00412	Zinc finger
HMMSmart	IPR001715	41	142	SM00033	Calponin-like actin-binding
HMMSmart	IPR001781	1030	1088	SM00132	Zinc finger
ProfileScan	IPR001715	39	143	PS50021	Calponin-like actin-binding
ProfileScan	IPR001781	1029	1095	PS50023	Zinc finger
ScanRegExp	IPR001781	1031	1067	PS00478	Zinc finger

Primer_f	AAGGGGGACTATTTATTCTGC
Primer_r	AGCCATACTCAATAAGACACG
PCR conditions	95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

Panel name	GeneBridge 4
Primer_f	AAGGGGGACTATTTATTCTGC
Primer_r	AGCCATACTCAATAAGACACG
PCR product length	173 bp
PCR conditions	95 °C15 sec62 °C60 sec30 cycles