KIAA1115

Product ID	ORK01151
Accession No	AB029038
Description	protein phosphatase 6, regulatory subunit 1
Clone name	hk05464
Vector information	The cDNA fragment was inserted at the SalI-NotI site of the ... The cDNA fragment was inserted at the SalI-NotI site of the pBluescript II SK(+) vector (GenBank Accession No. X52328, AmpR). The 5' end of the cDNA was repaired and ligated with the SalI adapter (5'TCGACCCACG CGTCCG3') and inserted at the SalI site of the vector. The 3'end of the cDNA was inserted at the NotI site of the vector.
cDNA sequence	DNA sequence (3961 bp) Predicted protein sequence (895 aa)
HaloTag ORF Clone	FHC01151
Flexi ORF Clone	FXC01151
Source	Human adult brain
Rouge ID	mKIAA1115 by Kazusa Mouse cDNA Project
Note	We replaced hk02303, former representative clones for KIAA1115 with hk05464. (2004/1/10)

Length: 3961 bp

Physical map

Restriction map

Prediction of protein coding region (GeneMark analysis).

	N-terminal truncation	Coding interruption
cloned DNA seq	No warning	No warning

Integrity of 3' end

Length of 3'UTR	748 bp
Genome contig ID	gi42406306r_60332960
PolyA signal sequence (AATAAA,-21)	+--------+--------+----*----+---- ATATTGCAAATATAAATAAAGGAAGGCAGTTTACG
Flanking genome sequence (100000 - 99951)	----+--------+--------+--------+--------+----* ATTCTGCTGGTCAGACCTTACGTTCTGGGATGCGGGGTGGGGAGCCTGTA

Ensembl ContigView (Add our DAS server as a DAS source)

	Chr	f/r	start	end	exon	identity	class
Ensembl gnome browser	19	r	60432960	60462175	24	99.9	Perfect prediction

Length: 895 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	ID%	Protein	Source
Q9UPN7	100.0	Serine/threonin...	Homo sapiens
EAW72353	100.0	SAPS domain fam...	Homo sapiens
AAH68014	100.0	SAPS1 protein [...	Homo sapiens
AAH02799	100.0	SAPS1 protein [...	Homo sapiens
XP_001489717	89.0	similar to SAPS...	Equus caballus

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against HUGE database (FASTA output, Multiple alignment)

Entry	Exp	ID%	HUGE_ID
AB046778	2.7e-47	46.6	KIAA1558
AB014585	2.9e-25	42.2	KIAA0685

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method	interpro_ID	From	To	Entry	Definition
HMMPfam	IPR007587	142	533	PF04499	SIT4 phosphatase-associated protein

Primer_f	AAATCTTCCGTCCTCCCGTGG
Primer_r	CTCTTCTCAGTGCAAATGGGG
PCR conditions	95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

Panel name	GeneBridge 4
Primer_f	AAATCTTCCGTCCTCCCGTGG
Primer_r	CTCTTCTCAGTGCAAATGGGG
PCR product length	167 bp
PCR conditions	95 °C15 sec66 °C60 sec30 cycles