Order Kazusa clone(s) from : ![]() |
Product ID | ORK00743 |
---|---|
Accession No | AB032951 |
Description | zinc finger, MYND-type containing 8 |
Clone name | hk07594 |
Vector information | |
cDNA sequence | DNA sequence (4147 bp) Predicted protein sequence (1205 aa) |
HaloTag ORF Clone |
FHC00743
![]() |
Flexi ORF Clone | FXC00743 |
Source | Human adult brain |
Rouge ID |
mKIAA1125
by Kazusa Mouse cDNA Project
|
N-terminal truncation | Coding interruption | |
---|---|---|
cloned DNA seq | No warning | No warning |
Length of 3'UTR | 332 bp |
---|---|
Genome contig ID | gi51511747r_45172512 |
PolyA signal sequence (ATTAAA,-34) |
+----*----+----*----+----*----+---- |
Flanking genome sequence (99969 - 99920) |
----+----*----+----*----+----*----+----*----+----* |
Ensembl ContigView (Add our DAS server as a DAS source)
Chr | f/r | start | end | exon | identity | class | |
---|---|---|---|---|---|---|---|
| 20 | r | 45272481 | 45417808 | 22 | 99.9 | Perfect prediction |
![]() |
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
Search method | interpro_ID | From | To | Entry | Definition |
---|---|---|---|---|---|
HMMPfam | IPR001965 | 109 | 152 | PF00628 | Zinc finger |
IPR001487 | 173 | 259 | PF00439 | Bromodomain | |
IPR000313 | 293 | 357 | PF00855 | PWWP | |
IPR002893 | 1047 | 1081 | PF01753 | Zinc finger | |
HMMSmart | IPR001965 | 109 | 150 | SM00249 | Zinc finger |
IPR001487 | 166 | 273 | SM00297 | Bromodomain | |
IPR000313 | 294 | 344 | SM00293 | PWWP | |
ProfileScan | IPR001965 | 107 | 152 | PS50016 | Zinc finger |
IPR001487 | 184 | 254 | PS50014 | Bromodomain | |
IPR000313 | 296 | 346 | PS50812 | PWWP | |
IPR002893 | 1047 | 1081 | PS50865 | Zinc finger | |
ScanRegExp | IPR001965 | 110 | 149 | PS01359 | Zinc finger |
IPR002893 | 1047 | 1081 | PS01360 | Zinc finger |
![]() |
Primer_f | GCACACAATCAGCACCTTCAG |
---|---|
Primer_r | TCTCATCACTGCTGCTCCAAC |
PCR conditions | 95 °C![]() ![]() ![]() ![]() ![]() ![]() ![]() |
Panel name | unigene |
---|---|
Primer_f | - |
Primer_r | - |
PCR product length | - |
PCR conditions | - |