KIAA1171

Product ID	ORK00755
Accession No	AB032997
Description	TBC1 domain family, member 24, transcript variant 1
Clone name	hh05501s1
Vector information	The cDNA fragment was inserted at the SalI-NotI site of the ... The cDNA fragment was inserted at the SalI-NotI site of the pYO326 vector. The 5' end of the cDNA was repaired and ligated with the SalI adapter (5'TCGACCCACG CGTCCG3') and inserted at the SalI site of the vector. The 3'end of the cDNA was inserted at the NotI site of the vector. pYO326 shuttle vector, pYO326 (Amp-r) was kindly provided by Y. Ohya (University of Tokyo).
cDNA sequence	DNA sequence (4340 bp) Predicted protein sequence (595 aa)
HaloTag ORF Clone	FHC00755
Flexi ORF Clone	FXC00755
Source	Human adult brain
Rouge ID	mKIAA1171 by Kazusa Mouse cDNA Project
Note	We replaced hh05501, former representative clones for KIAA1171 with hh05501s1. (2002/5/10)

Length: 4340 bp

Physical map

Restriction map

Prediction of protein coding region (GeneMark analysis).

	N-terminal truncation	Coding interruption
cloned DNA seq	No warning	No warning

Integrity of 3' end

Length of 3'UTR	2527 bp
Genome contig ID	gi51511732f_2386034
PolyA signal sequence (None)	+--------+--------+----*----+---- GGCTGCTCTGCCTATGAAGTAGCCATTCTTTGTTT
Flanking genome sequence (107455 - 107504)	----+--------+--------+--------+--------+----* AAAAAAAAAAAAAGCCAACATTTGTTGAAACTGCATAATAAATTATCATT

Ensembl ContigView (Add our DAS server as a DAS source)

	Chr	f/r	start	end	exon	identity	class
Ensembl gnome browser	16	f	2465155	2493487	8	99.8	Perfect prediction

Length: 595 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	ID%	Protein	Source
BAG09985	100.0	TBC1 domain fam...	synthetic construct
Q9ULP9	99.8	TBC1 domain fam...	Homo sapiens
XP_001085824	98.7	similar to CG93...	Macaca mulatta
AAI12390	98.7	TBC1 domain fam...	Homo sapiens
XP_001085929	97.7	similar to CG93...	Macaca mulatta

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against HUGE database (FASTA output, Multiple alignment)

Entry	Exp	ID%	HUGE_ID
AB028978	4.3e-06	24.7	KIAA1055
AB020689	0.00089	24.3	KIAA0882

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method	interpro_ID	From	To	Entry	Definition
HMMPfam	IPR000195	83	298	PF00566	RabGAP/TBC
HMMPfam	IPR006571	404	590	PF07534	TLDc
HMMSmart	IPR000195	78	295	SM00164	RabGAP/TBC
HMMSmart	IPR006571	378	590	SM00584	TLDc

Prediction of transmembrane (TM) segments

Method	No.	N terminal	transmembrane region	C terminal	type	length
SOSUI2	1	164	ISFCPALPAVVALLLHYSIDEAE	186	PRIMARY	23
SOSUI2	2	260	YFARVFDVFLVEGYKVLYRVALA	282	SECONDARY	23

Primer_f	CTATGACTGGAATGCTGCAAG
Primer_r	AACCTGCTGGACTTAACTCGC
PCR conditions	95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

Panel name	unigene
Primer_f	-
Primer_r	-
PCR product length	-
PCR conditions	-