KIAA0882

Product ID	ORK01130
Accession No	AB020689
Description	TBC1 domain family, member 9 (with GRAM domain)
Clone name	hk07544s1
Vector information	The cDNA fragment was inserted at the SalI-NotI site of the ... The cDNA fragment was inserted at the SalI-NotI site of the pBluescript II SK(+) vector (GenBank Accession No. X52328, AmpR). The 5' end of the cDNA was repaired and ligated with the SalI adapter (5'TCGACCCACG CGTCCG3') and inserted at the SalI site of the vector. The 3'end of the cDNA was inserted at the NotI site of the vector.
cDNA sequence	DNA sequence (5286 bp) Predicted protein sequence (1291 aa)
HaloTag ORF Clone	FHC01130
Flexi ORF Clone	FXC01130
Source	Human adult brain
Rouge ID	mKIAA0882 by Kazusa Mouse cDNA Project
Note	We replaced hk07544, former representative clones for KIAA0882 with hk07544s1. (2002/5/10)

Length: 5286 bp

Physical map

Restriction map

Prediction of protein coding region (GeneMark analysis).

	N-terminal truncation	Coding interruption
cloned DNA seq	Warning	No warning

Integrity of 3' end

Length of 3'UTR	1410 bp
Genome contig ID	gi89161207r_141661389
PolyA signal sequence (AATAAA,-21)	+--------+--------+----*----+---- GCTAAATGTGAACAAATAAAATACAGCAAATACTC
Flanking genome sequence (100000 - 99951)	----+--------+--------+--------+--------+----* AGATACAGCTTTTTATCTTTGTGCTTGAGTTCCTGCCTAAGGCAATAACA

Ensembl ContigView (Add our DAS server as a DAS source)

	Chr	f/r	start	end	exon	identity	class
Ensembl gnome browser	4	r	141761389	141896724	21	99.6	Perfect prediction

Length: 1291 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	ID%	Protein	Source
Q6ZT07	100.0	TBC1 domain fam...	Homo sapiens
XP_533283	97.5	similar to Y45F...	Canis lupus fam...
XP_001090502	100.0	similar to Y45F...	Macaca mulatta
Q3UYK3	95.9	TBC1 domain fam...	Mus musculus
BAE22209	95.7	unnamed protein...	Mus musculus

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against HUGE database (FASTA output, Multiple alignment)

Entry	Exp	ID%	HUGE_ID
AB014576	0	62.9	KIAA0676
AB028978	1.4e-21	33.6	KIAA1055
AB029031	1.9e-14	27.4	KIAA1108
D13644	1.6e-12	27.6	KIAA0019
AB011175	2.2e-12	26.5	KIAA0603

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method	interpro_ID	From	To	Entry	Definition
HMMPfam	IPR004182	171	238	PF02893	GRAM
	IPR004182	318	386	PF02893	GRAM
	IPR000195	537	749	PF00566	RabGAP/TBC
	IPR002048	915	943	PF00036	Calcium-binding EF-hand
HMMSmart	IPR004182	171	238	SM00568	GRAM
	IPR004182	318	386	SM00568	GRAM
	IPR000195	537	750	SM00164	RabGAP/TBC
ProfileScan	IPR000195	540	727	PS50086	RabGAP/TBC
ProfileScan	IPR002048	911	946	PS50222	Calcium-binding EF-hand

Prediction of transmembrane (TM) segments

Method	No.	N terminal	transmembrane region	C terminal	type	length
SOSUI2	1	696	STISLSWFLTLFLSVMPFESAVV	718	PRIMARY	23

Primer_f	AAGTAGCAGCAAAGACAGAGG
Primer_r	ATCCAGTATCAGAAGCATCAG
PCR conditions	95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

Panel name	GeneBridge 4
Primer_f	AAGTAGCAGCAAAGACAGAGG
Primer_r	ATCCAGTATCAGAAGCATCAG
PCR product length	97 bp
PCR conditions	95 °C15 sec62 °C60 sec30 cycles