Order Kazusa clone(s) from :
Japan
||
Other countries |
Product ID | ORK07069 |
---|---|
Accession No | AB014576 |
Description | TBC1 domain family, member 9B (with GRAM domain) |
Clone name | hk02596 |
Vector information | |
cDNA sequence | DNA sequence (4491 bp) Predicted protein sequence (1262 aa) |
Source | Human adult brain |
Rouge ID |
mKIAA0676
by Kazusa Mouse cDNA Project
|
N-terminal truncation | Coding interruption | |
---|---|---|
cloned DNA seq | Warning | No warning |
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.Result of homology search against HUGE database (FASTA output, Multiple alignment)
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
Search method | interpro_ID | From | To | Entry | Definition |
---|---|---|---|---|---|
HMMPfam | IPR004182 | 154 | 221 | PF02893 | GRAM |
IPR004182 | 300 | 368 | PF02893 | GRAM | |
IPR000195 | 517 | 729 | PF00566 | RabGAP/TBC | |
IPR002048 | 895 | 923 | PF00036 | Calcium-binding EF-hand | |
HMMSmart | IPR004182 | 154 | 221 | SM00568 | GRAM |
IPR004182 | 300 | 368 | SM00568 | GRAM | |
IPR000195 | 517 | 730 | SM00164 | RabGAP/TBC | |
ProfileScan | IPR000195 | 520 | 707 | PS50086 | RabGAP/TBC |
IPR002048 | 891 | 926 | PS50222 | Calcium-binding EF-hand |
Method | No. | N terminal | transmembrane region | C terminal | type | length | SOSUI2 | 1 | 611 | VTSVLLLYGSEEEAFWLLVALCE | 633 | SECONDARY | 23 | 2 | 670 | QDLGVISSISLSWFLTLFLSVMP | 692 | PRIMARY | 23 | 3 | 698 | VIVDCFFYEGIKVILQVALAVLD | 720 | PRIMARY | 23 |
---|
RT-PCR |
---|
RT-PCR-ELISA |
Primer_f | AGAGACAGTTCAGCACCGCCA |
---|---|
Primer_r | CACTGATGACACCTTGGGCCA |
PCR conditions | 95 °C30 sec55 °C30 sec72 °C60 sec30 cycles |
Panel name | GeneBridge 4 |
---|---|
Primer_f | AGAGACAGTTCAGCACCGCCA |
Primer_r | CACTGATGACACCTTGGGCCA |
PCR product length | 93 bp |
PCR conditions | 95 °C15 sec66 °C60 sec30 cycles |