Order Kazusa clone(s) from : ![]() |
Product ID | ORK07061 |
---|---|
Accession No | AB029031 |
Description | TBC1 (tre-2/USP6, BUB2, cdc16) domain family, member 1 |
Clone name | hh03387s1 |
Vector information | |
cDNA sequence | DNA sequence (2576 bp) Predicted protein sequence (763 aa) |
Source | Human adult brain |
Rouge ID |
mKIAA1108
by Kazusa Mouse cDNA Project
|
Note | We replaced hh03387, former representative clones for KIAA1108 with hh03387s1. (2002/5/10) |
N-terminal truncation | Coding interruption | |
---|---|---|
cloned DNA seq | Warning | No warning |
Length of 3'UTR | 284 bp |
---|---|
Genome contig ID | gi89161207f_37605809 |
PolyA signal sequence (AATAAA,-21) |
+----*----+----*----+----*----+---- |
Flanking genome sequence (209828 - 209877) |
----+----*----+----*----+----*----+----*----+----* |
Ensembl ContigView (Add our DAS server as a DAS source)
Chr | f/r | start | end | exon | identity | class | |
---|---|---|---|---|---|---|---|
| 4 | f | 37705809 | 37815635 | 14 | 100.0 | Perfect prediction |
![]() |
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
![]() |
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
![]() |
Primer_f | CTCCAACTTGCAATTCAGGGG |
---|---|
Primer_r | GCATTTATTCACGTCCACGCC |
PCR conditions | 95 °C![]() ![]() ![]() ![]() ![]() ![]() ![]() |
Panel name | UniGene |
---|---|
Primer_f | - |
Primer_r | - |
PCR product length | - |
PCR conditions | - |