KIAA1187

Product ID	ORK00758
Accession No	AB033013
Description	MAP7 domain containing 1, transcript variant 2
Clone name	fk03027
Vector information	The cDNA fragment was inserted at the SalI-NotI site of the ... The cDNA fragment was inserted at the SalI-NotI site of the pBluescript II SK(+) vector (GenBank Accession No. X52328, AmpR). The 5' end of the cDNA was repaired and ligated with the SalI adapter (5'TCGACCCACG CGTCCG3') and inserted at the SalI site of the vector. The 3'end of the cDNA was inserted at the NotI site of the vector.
cDNA sequence	DNA sequence (3454 bp) Predicted protein sequence (813 aa)
HaloTag ORF Clone	FHC00758
Flexi ORF Clone	FXC00758
Source	Human fetal brain
Rouge ID	mKIAA1187 by Kazusa Mouse cDNA Project
Note	We replaced hg02694a, former representative clones for KIAA1187 with fk03027. (2002/5/10)

Length: 3454 bp

Physical map

Restriction map

Prediction of protein coding region (GeneMark analysis).

	N-terminal truncation	Coding interruption
cloned DNA seq	No warning	No warning

Integrity of 3' end

Length of 3'UTR	589 bp
Genome contig ID	gi89161185f_36294153
PolyA signal sequence (AATAAA,-19)	+--------+--------+----*----+---- ATTAAATGTCTCCAGAAATAAAGAATAATTCTGCC
Flanking genome sequence (124884 - 124933)	----+--------+--------+--------+--------+----* AATCCTGCCTGTTCTTGGAGCTGGTGGCGGAGGTGGGAGCAGATGGCCTC

Ensembl ContigView (Add our DAS server as a DAS source)

	Chr	f/r	start	end	exon	identity	class
Ensembl gnome browser	1	f	36394153	36419035	16	100.0	Perfect prediction

Length: 813 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	Exp	ID%	Protein	Source
BAG09988	1.3e-165	100.0	MAP7 domain-con...	synthetic construct
XP_001110370	1.2e-160	97.1	similar to prol...	Macaca mulatta
XP_001110203	3e-157	97.2	similar to prol...	Macaca mulatta
EAX07381	2e-148	91.8	arginine/prolin...	Homo sapiens
XP_001057759	7.4e-140	84.9	similar to prol...	Rattus norvegicus

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against HUGE database (FASTA output, Multiple alignment)

No significant homologues

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method	interpro_ID	From	To	Entry	Definition
HMMPfam	IPR008604	549	708	PF05672	E-MAP-115

Primer_f	ACAAGAGTCTGAGCCGAACAC
Primer_r	TGGTAGGTGATGCAGAGGAGC
PCR conditions	95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

Panel name	unigene
Primer_f	-
Primer_r	-
PCR product length	-
PCR conditions	-