Gene/Protein Characteristic Table for KIAA1205
Order Kazusa clone(s) from : Japan || Other countries
Product ID ORK00766
Accession No AB033031
Description proline rich 12
Clone name fg03511a
Vector information
The cDNA fragment was inserted at the SalI-NotI site of the ...
cDNA sequence DNA sequence (4470 bp)
Predicted protein sequence (1217 aa)
Flexi ORF Clone FXC00766
Source Human fetal brain
Rouge ID mKIAA1205 by Kazusa Mouse cDNA Project
Features of the cloned cDNA sequence
Description

Length: 4470 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis).

N-terminal truncation Coding interruption
cloned DNA seq Warning No warning
Integrity of 3' end
Length of 3'UTR 816 bp
Genome contig ID gi42406306f_54691915
PolyA signal sequence
(None)
+----*----+----*----+----*----+----
AACCAGCCAAACGAAAACCCAACGGCAAACACTTT
Flanking genome sequence
(129594 - 129643)
----+----*----+----*----+----*----+----*----+----*
ACCGGCAGGCTGGAGTGCCTCTGTCCTGCGGCGCTGGAGTGGGTGGCAGT

Ensembl ContigView (Add our DAS server as a DAS source)


Chr f/r start end exon identity class
Ensembl gnome browser 19 f 54790585 54821507 12 98.9 Perfect prediction
Features of the protein sequence
Description

Length: 1217 aa
Result of homology search against nr database (FASTA output, Multiple alignment)
Entry Exp ID% Protein Source
Q9ULL5 0 100.0 Proline-rich pr...
Homo sapiens
NP_065770 0 99.3 proline rich 12...
Homo sapiens
EAW52505 0 99.7 hCG2045936 [Hom...
Homo sapiens
XP_541492 0 94.3 similar to CG17...
Canis lupus fam...
XP_608073 0 92.3 similar to prol...
Bos taurus
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
Result of homology search against HUGE database (FASTA output, Multiple alignment)
No significant homologues
Result of motif / domain search (InterProScan and SOSUI)

Result of InterProScan

Search method interpro_ID From To Entry Definition
HMMPfam IPR000637 349 361 PF02178 HMG-I and HMG-Y
IPR000637 383 395 PF02178 HMG-I and HMG-Y
Expression profile
Description

RT-PCR
Experimental conditions
Primer_f
Primer_r
PCR conditions °C sec °C sec cycles

RH mapping information
Description

Chromosome No. 19
Experimental conditions
Panel name GeneBridge 4
Primer_f ACTGCCCATCCCCCATTGTTG
Primer_r AGCAAGAGACAAAGGGTAGTG
PCR product length 118 bp
PCR conditions 95 °C15 sec64 °C60 sec30 cycles
Order Kazusa clone(s) from : Japan || Other countries
Back to the HUGE Protein Database homepage
Send a message to office AT kazusa.or.jp