KIAA1217

Product ID	ORK00770
Accession No	AB033043
Description	KIAA1217, transcript variant 2
Clone name	fh03001s1
Vector information	The cDNA fragment was inserted at the SalI-NotI site of the ... The cDNA fragment was inserted at the SalI-NotI site of the pBluescript II SK(+) vector (GenBank Accession No. X52328, AmpR). The 5' end of the cDNA was repaired and ligated with the SalI adapter (5'TCGACCCACG CGTCCG3') and inserted at the SalI site of the vector. The 3'end of the cDNA was inserted at the NotI site of the vector.
cDNA sequence	DNA sequence (6127 bp) Predicted protein sequence (1339 aa)
HaloTag ORF Clone	FHC00770
Flexi ORF Clone	FXC00770
Source	Human fetal brain
Rouge ID	mKIAA1217 by Kazusa Mouse cDNA Project
Note	We replaced fh03001, former representative clones for KIAA1217 with fh03001s1. (2002/5/10)

Length: 6127 bp

Physical map

Restriction map

Prediction of protein coding region (GeneMark analysis).

	N-terminal truncation	Coding interruption
cloned DNA seq	No warning	No warning

Integrity of 3' end

Length of 3'UTR	1523 bp
Genome contig ID	gi89161187f_23923681
PolyA signal sequence (AATAAA,-23)	+--------+--------+----*----+---- AAGTAAAGTGGAAATAAAATGTCTTTATCACTTGG
Flanking genome sequence (953104 - 953153)	----+--------+--------+--------+--------+----* CTTTTTTTCTTTTGAGTCCTCAACTTAAAAAATTATTGTTGGCCTAGAGG

Ensembl ContigView (Add our DAS server as a DAS source)

	Chr	f/r	start	end	exon	identity	class
Ensembl gnome browser	10	f	24023681	24876783	19	99.6	Perfect prediction

Length: 1339 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	ID%	Protein	Source
XP_001098636	97.8	similar to p130...	Macaca mulatta
XP_001098044	97.8	similar to p130...	Macaca mulatta
AAI58052	85.6	Etl4 protein [M...	Mus musculus
XP_001098739	96.1	similar to p130...	Macaca mulatta
XP_507697	68.2	hypothetical pr...	Pan troglodytes

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against HUGE database (FASTA output, Multiple alignment)

Entry	Exp	ID%	HUGE_ID
AB051471	4.2e-18	35.4	KIAA1684

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method	interpro_ID	From	To	Entry	Definition
None	-	-	-	-	-

Prediction of transmembrane (TM) segments

Method	No.	N terminal	transmembrane region	C terminal	type	length
SOSUI2	1	2	TALLLHGVFLLLLIFFLEQGK	22	PRIMARY	21

Primer_f	TCCGTCTCACTGAATCAAGGT
Primer_r	AATGTAACTCCGACTTGTGCC
PCR conditions	95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

Panel name	unigene
Primer_f	-
Primer_r	-
PCR product length	-
PCR conditions	-