KIAA1219

Product ID	ORK01627
Accession No	AB033045
Description	Ral GTPase activating protein, beta subunit (non-catalytic), transcript variant 3
Clone name	ef03859
Vector information	The cDNA fragment was inserted at the XhoI-SacI site of the ... The cDNA fragment was inserted at the XhoI-SacI site of the pBC SK+ vector(Cm resistance; http://www.kazusa.or.jp/huge/vectorinfo/pbcskp_s.txt) with sequences including attB1 and attB2 sites (CTCGAGCAGC TGAAGCTTTC ACAAGTTTGT ACAAAAAAGC AGGCTCTTC-5' end of cDNA, GAGCTCTCAC CACTTTGTAC AAGAAAGCTG GGCGGCCGCT TTTTTTTTTT TTTTTTT-3' end of cDNA).
cDNA sequence	DNA sequence (8654 bp) Predicted protein sequence (1534 aa)
HaloTag ORF Clone	FHC01627
Flexi ORF Clone	FXC01627
Source
Rouge ID	mKIAA1219 by Kazusa Mouse cDNA Project
Note	We replaced fh03044 and bg00043, former representative clones for KIAA1219 with ef03859. (2002/5/10,2002/5/10)

Length: 8654 bp

Physical map

Restriction map

Prediction of protein coding region (GeneMark analysis).

	N-terminal truncation	Coding interruption
cloned DNA seq	No warning	No warning

Integrity of 3' end

Length of 3'UTR	3894 bp
Genome contig ID	gi51511747f_36434873
PolyA signal sequence (ATTAAA,-29)	+--------+--------+----*----+---- TAGTCAATTAAATTTTAAGGAGATTCTTATCTAAT
Flanking genome sequence (206045 - 206094)	----+--------+--------+--------+--------+----* AACTTTGTGTGTGCTTTTGGATACAGGCTGAGGCTTTACTCCTACACTGG

Ensembl ContigView (Add our DAS server as a DAS source)

	Chr	f/r	start	end	exon	identity	class
Ensembl gnome browser	20	f	36534873	36640916	30	99.5	Perfect prediction

Length: 1534 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	ID%	Protein	Source
NP_808326	97.3	hypothetical pr...	Mus musculus
CAM14581	97.1	novel protein [...	Mus musculus
EDL06268	96.1	mCG15732 [Mus m...	Mus musculus
CAH65287	92.0	hypothetical pr...	Gallus gallus
CAM27457	99.7	RP5-1100H13.1 [...	Homo sapiens

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against HUGE database (FASTA output, Multiple alignment)

No significant homologues

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method	interpro_ID	From	To	Entry	Definition
ProfileScan	IPR000331	1188	1432	PS50085	Rap/ran-GAP

Primer_f	GCTCTAAATTCTGGCAACTCC
Primer_r	GGCAGATGTTATTGTGAGCAG
PCR conditions	95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

Panel name	unigene
Primer_f	-
Primer_r	-
PCR product length	-
PCR conditions	-