KIAA1229

Product ID	ORK00774
Accession No	AB033055
Description	outer dense fiber of sperm tails 2-like, transcript variant 2
Clone name	fh05775
Vector information	The cDNA fragment was inserted at the SalI-NotI site of the ... The cDNA fragment was inserted at the SalI-NotI site of the pBluescript II SK(+) vector (GenBank Accession No. X52328, AmpR). The 5' end of the cDNA was repaired and ligated with the SalI adapter (5'TCGACCCACG CGTCCG3') and inserted at the SalI site of the vector. The 3'end of the cDNA was inserted at the NotI site of the vector.
cDNA sequence	DNA sequence (5654 bp) Predicted protein sequence (696 aa)
HaloTag ORF Clone	FHC00774
Flexi ORF Clone	FXC00774
Source	Human fetal brain
Rouge ID	mKIAA1229 by Kazusa Mouse cDNA Project

Length: 5654 bp

Physical map

Restriction map

Prediction of protein coding region (GeneMark analysis).

	N-terminal truncation	Coding interruption
cloned DNA seq	No warning	No warning

Integrity of 3' end

Length of 3'UTR	3461 bp
Genome contig ID	gi89161185r_86487000
PolyA signal sequence (AATAAA,-26)	+--------+--------+----*----+---- CAATGTTTGAATAAATTGTCAAATTTATTTTCTCT
Flanking genome sequence (100000 - 99951)	----+--------+--------+--------+--------+----* AAGTAGTAGATTTTTATTATGAGTCTAAAATGTGATTGGGTAAAAAAATA

Ensembl ContigView (Add our DAS server as a DAS source)

	Chr	f/r	start	end	exon	identity	class
Ensembl gnome browser	1	r	86587000	86634533	18	99.3	Perfect prediction

Length: 696 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	Exp	ID%	Protein	Source
BAG10004	6.9e-200	100.0	outer dense fib...	synthetic construct
Q9ULJ1	1.8e-199	99.8	Outer dense fib...	Homo sapiens
EAW73188	2e-197	99.8	outer dense fib...	Homo sapiens
EAW73191	1.6e-150	96.9	outer dense fib...	Homo sapiens
AAH91490	8.9e-141	91.4	ODF2L protein [...	Homo sapiens

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against HUGE database (FASTA output, Multiple alignment)

No significant homologues

Primer_f	TCATCCTGTGGCTTTGTACTG
Primer_r	AATGACACCTGATACCTTCTG
PCR conditions	95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

Chromosome No. 1

Experimental conditions

Panel name	GeneBridge 4
Primer_f	TCATCCTGTGGCTTTGTACTG
Primer_r	AATGACACCTGATACCTTCTG
PCR product length	102 bp
PCR conditions	95 °C15 sec62 °C60 sec30 cycles