KIAA1230

Product ID	ORK06448
Accession No	AB033056
Description	PTPRF interacting protein, binding protein 1 (liprin beta 1)
Clone name	fh06860s1
Vector information	The cDNA fragment was inserted at the SalI-NotI site of the ... The cDNA fragment was inserted at the SalI-NotI site of the pBluescript II SK(+) vector (GenBank Accession No. X52328, AmpR). The 5' end of the cDNA was repaired and ligated with the SalI adapter (5'TCGACCCACG CGTCCG3') and inserted at the SalI site of the vector. The 3'end of the cDNA was inserted at the NotI site of the vector.
cDNA sequence	DNA sequence (5720 bp) Predicted protein sequence (932 aa)
Source	Human fetal brain
Rouge ID	mKIAA1230 by Kazusa Mouse cDNA Project
Note	We replaced fh06860, former representative clones for KIAA1230 with fh06860s1. (2002/5/10)

Length: 5720 bp

Physical map

Restriction map

Prediction of protein coding region (GeneMark analysis).

	N-terminal truncation	Coding interruption
cloned DNA seq	No warning	No warning

Integrity of 3' end

Length of 3'UTR	2682 bp
Genome contig ID	gi89161190f_27468382
PolyA signal sequence (AATAAA,-25)	+--------+--------+----*----+---- TATGAAAGGAAATAAAGTCAATTGATAATTGCCTC
Flanking genome sequence (271383 - 271432)	----+--------+--------+--------+--------+----* ATTTTTATTGCCCTTATTTCATTTTCCGTTGTTCATAGTAACAGGCTTTG

Ensembl ContigView (Add our DAS server as a DAS source)

	Chr	f/r	start	end	exon	identity	class
Ensembl gnome browser	12	f	27568382	27739763	27	99.4	Perfect prediction

Length: 932 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	ID%	Protein	Source
AAH50281	100.0	PPFIBP1 protein...	Homo sapiens
Q86W92	99.9	Liprin-beta-1; ...	Homo sapiens
EAW96558	100.0	PTPRF interacti...	Homo sapiens
XP_001363898	84.7	similar to PTPR...	Monodelphis dom...
BAG57559	99.5	unnamed protein...	Homo sapiens

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against HUGE database (FASTA output, Multiple alignment)

Entry	Exp	ID%	HUGE_ID
AB020704	1.5e-07	31.5	KIAA0897
AB014554	8.9e-07	24.7	KIAA0654

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method	interpro_ID	From	To	Entry	Definition
HMMPfam	IPR001660	566	630	PF00536	Sterile alpha motif SAM
	IPR001660	638	701	PF00536	Sterile alpha motif SAM
	IPR011510	725	797	PF07647	Sterile alpha motif homology 2
HMMSmart	IPR001660	565	632	SM00454	Sterile alpha motif SAM
	IPR001660	637	703	SM00454	Sterile alpha motif SAM
	IPR001660	725	797	SM00454	Sterile alpha motif SAM
ProfileScan	IPR001660	568	632	PS50105	Sterile alpha motif SAM
ProfileScan	IPR001660	640	703	PS50105	Sterile alpha motif SAM

Primer_f	ATCAAAAGGGCCATCCAGGTC
Primer_r	TATTCTGCCAAGTCCACGGAG
PCR conditions	95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

Panel name	GeneBridge 4
Primer_f	ATCAAAAGGGCCATCCAGGTC
Primer_r	TATTCTGCCAAGTCCACGGAG
PCR product length	158(800) bp
PCR conditions	95 °C15 sec64 °C60 sec30 cycles