Order Kazusa clone(s) from : ![]() |
Product ID | ORK00775 |
---|---|
Accession No | AB033060 |
Description | aryl-hydrocarbon receptor repressor, transcript variant 1 |
Clone name | fh08618 |
Vector information | |
cDNA sequence | DNA sequence (5726 bp) Predicted protein sequence (727 aa) |
HaloTag ORF Clone |
FHC00775
![]() |
Flexi ORF Clone | FXC00775 |
Source | Human fetal brain |
Rouge ID |
mKIAA1234
by Kazusa Mouse cDNA Project
|
N-terminal truncation | Coding interruption | |
---|---|---|
cloned DNA seq | No warning | No warning |
Length of 3'UTR | 3521 bp |
---|---|
Genome contig ID | gi51511721f_257291 |
PolyA signal sequence (AATACA,-29) |
+----*----+----*----+----*----+---- |
Flanking genome sequence | None |
Ensembl ContigView (Add our DAS server as a DAS source)
Chr | f/r | start | end | exon | identity | class | |
---|---|---|---|---|---|---|---|
| 5 | f | 357289 | 499796 | 14 | 99.1 | Both No-hit |
![]() |
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
Search method | interpro_ID | From | To | Entry | Definition |
---|---|---|---|---|---|
HMMPfam | IPR001092 | 46 | 90 | PF00010 | Basic helix-loop-helix dimerisation region bHLH |
IPR013767 | 122 | 187 | PF00989 | PAS fold | |
HMMSmart | IPR001092 | 43 | 97 | SM00353 | Basic helix-loop-helix dimerisation region bHLH |
IPR000014 | 122 | 188 | SM00091 | PAS | |
ProfileScan | IPR001092 | 25 | 90 | PS50888 | Basic helix-loop-helix dimerisation region bHLH |
IPR000014 | 125 | 190 | PS50112 | PAS |
![]() |
Primer_f | CAGATTGAGTGGTGGGTTGCT |
---|---|
Primer_r | GGGAGTTTTTGTTGCCGTTGA |
PCR conditions | 95 °C![]() ![]() ![]() ![]() ![]() ![]() ![]() |
Panel name | GeneBridge 4 |
---|---|
Primer_f | CAGATTGAGTGGTGGGTTGCT |
Primer_r | GGGAGTTTTTGTTGCCGTTGA |
PCR product length | 177 bp |
PCR conditions | 95 °C![]() ![]() ![]() ![]() |