Order Kazusa clone(s) from : ![]() |
Product ID | ORK00780 |
---|---|
Accession No | AB033073 |
Description | sulfatase 2, transcript variant 1 |
Clone name | pj01452 |
Vector information | |
cDNA sequence | DNA sequence (4397 bp) Predicted protein sequence (885 aa) |
Flexi ORF Clone | FXC00780 |
Source | Human brain (hippocampus) |
Rouge ID |
mKIAA1247
by Kazusa Mouse cDNA Project
|
Note | We replaced hh03128a, former representative clones for KIAA1247 with pj01452. (2001/5/29) |
N-terminal truncation | Coding interruption | |
---|---|---|
cloned DNA seq | No warning | No warning |
Length of 3'UTR | 1454 bp |
---|---|
Genome contig ID | gi51511747r_45619063 |
PolyA signal sequence (None) |
+----*----+----*----+----*----+---- |
Flanking genome sequence (100000 - 99951) |
----+----*----+----*----+----*----+----*----+----* |
Ensembl ContigView (Add our DAS server as a DAS source)
Chr | f/r | start | end | exon | identity | class | |
---|---|---|---|---|---|---|---|
| 20 | r | 45719063 | 45848215 | 21 | 99.5 | Perfect prediction |
![]() |
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
![]() |
Primer_f | TAAGAAACAACAGAGGTGGAC |
---|---|
Primer_r | CTGAAGTTATCTCTGCTCCTG |
PCR conditions | 95 °C![]() ![]() ![]() ![]() ![]() ![]() ![]() |
Panel name | unigene |
---|---|
Primer_f | - |
Primer_r | - |
PCR product length | - |
PCR conditions | - |