Gene/Protein Characteristic Table for KIAA1001
Order Kazusa clone(s) from : Japan || Other countries
Product ID ORK01621
Accession No AB023218
Description arylsulfatase G, transcript variant 1
Clone name hk09652
Vector information
The cDNA fragment was inserted at the SalI-NotI site of the ...
cDNA sequence DNA sequence (4304 bp)
Predicted protein sequence (551 aa)
Flexi ORF Clone FXC01621
Source Human adult brain
Rouge ID mKIAA1001 by Kazusa Mouse cDNA Project
Features of the cloned cDNA sequence
Description

Length: 4304 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis).

N-terminal truncation Coding interruption
cloned DNA seq No warning No warning

Ensembl ContigView (Add our DAS server as a DAS source)


Chr f/r start end exon identity class
Ensembl gnome browser 17 f 63814772 63930467 11 99.4 Perfect prediction
Features of the protein sequence
Description

Length: 551 aa
Result of homology search against nr database (FASTA output, Multiple alignment)
Entry Exp ID% Protein Source
BAG09935 0 100.0 arylsulfatase G...
synthetic construct
Q96EG1 0 99.8 Arylsulfatase G...
Homo sapiens
AAQ88746 0 99.4 GWLF839 [Homo s...
Homo sapiens
XP_001494339 1e-192 87.2 similar to aryl...
Equus caballus
Q32KH9 6e-192 86.6 Arylsulfatase G...
Canis lupus fam...
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
Result of homology search against HUGE database (FASTA output, Multiple alignment)
Entry Exp ID% HUGE_ID
AB033073 8.3e-05 22.4 KIAA1247
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
Result of motif / domain search (InterProScan and SOSUI)

Result of InterProScan

Search method interpro_ID From To Entry Definition
HMMPfam IPR000917 60 419 PF00884 Sulphatase
ScanRegExp IPR000917 108 120 PS00523 Sulphatase
IPR000917 155 165 PS00149 Sulphatase

Prediction of transmembrane (TM) segments
Method No. N terminal transmembrane region C terminal type length
SOSUI2 1 29 WLFLKVLLAGVSFSGFLYPLVDF 51 PRIMARY 23
Expression profile
Description

RT-PCR-ELISA
Experimental conditions
Primer_f GAAAGAGGTGGTGCGGAGTAC
Primer_r TGACAGCGGCAGGCAATTTGG
PCR conditions 95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

RH mapping information
Description

Chromosome No. 17
Experimental conditions
Panel name UniGene
Primer_f -
Primer_r -
PCR product length -
PCR conditions -
Order Kazusa clone(s) from : Japan || Other countries
Back to the HUGE Protein Database homepage
Send a message to office AT kazusa.or.jp