KIAA1254

Product ID	ORK00206
Accession No	AB033080
Description	cell cycle progression 1, transcript variant 1
Clone name	hh14357s1
Vector information	The cDNA fragment was inserted at the SalI-NotI site of the ... The cDNA fragment was inserted at the SalI-NotI site of the pBluescript II SK(+) vector (GenBank Accession No. X52328, AmpR). The 5' end of the cDNA was repaired and ligated with the SalI adapter (5'TCGACCCACG CGTCCG3') and inserted at the SalI site of the vector. The 3'end of the cDNA was inserted at the NotI site of the vector.
cDNA sequence	DNA sequence (6213 bp) Predicted protein sequence (758 aa)
HaloTag ORF Clone	FHC00206
Flexi ORF Clone	FXC00206
Source	Human adult brain
Rouge ID	mKIAA1254 by Kazusa Mouse cDNA Project
Note	We replaced hh14357, former representative clones for KIAA1254 with hh14357s1. (2002/5/10)

Length: 6213 bp

Physical map

Restriction map

Prediction of protein coding region (GeneMark analysis).

	N-terminal truncation	Coding interruption
cloned DNA seq	No warning	No warning

Integrity of 3' end

Length of 3'UTR	3855 bp
Genome contig ID	gi51511731r_53335134
PolyA signal sequence (AATAAA,-20)	+--------+--------+----*----+---- TATCGTGGAAGAAACAATAAAACTACACCATGAGG
Flanking genome sequence (100000 - 99951)	----+--------+--------+--------+--------+----* AAAACTAAAGGTCTTTATTTAAAATCTGGCATTGTATTAACATGTAATTT

Ensembl ContigView (Add our DAS server as a DAS source)

	Chr	f/r	start	end	exon	identity	class
Ensembl gnome browser	15	r	53435134	53487785	8	99.1	Perfect prediction

Length: 758 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	ID%	Protein	Source
BAG11298	100.0	cell cycle prog...	synthetic construct
Q9ULG6	99.9	Cell cycle prog...	Homo sapiens
XP_523082	99.2	cell cycle prog...	Pan troglodytes
BAF85484	99.9	unnamed protein...	Homo sapiens
XP_001171139	99.2	hypothetical pr...	Pan troglodytes

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against HUGE database (FASTA output, Multiple alignment)

No significant homologues

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method	interpro_ID	From	To	Entry	Definition
None	-	-	-	-	-

Prediction of transmembrane (TM) segments

Method	No.	N terminal	transmembrane region	C terminal	type	length
SOSUI2	1	212	FSSGLNKCVILALVIAISMGFGH	234	PRIMARY	23

Primer_f	AATCTGAAGACCGGCTAGTTG
Primer_r	CTGTTGACGCTTCTGAATCTG
PCR conditions	95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

Panel name	unigene
Primer_f	-
Primer_r	-
PCR product length	-
PCR conditions	-